EMAIL THIS PAGE TO A FRIEND

OR2W1

olfactory receptor, family 2, subfamily W, member 1

22 Gene Product Result for
Synonyms: hs6M1-15
Gene ID:
Human(26692) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(782431) olfactory receptor, family 2, subfamily W, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030903 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030903 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077638 predicted 651
2 SASI_Hs02_00358433 predicted 277
3 SASI_Hs02_00358434 predicted 596
4 SASI_Hs01_00077639 predicted 742
5 SASI_Hs01_00077640 predicted 467
6 SASI_Hs01_00077641 predicted 496
7 SASI_Hs02_00358435 predicted 505
8 SASI_Hs02_00358436 predicted 262
9 SASI_Hs01_00077646 predicted 605
10 SASI_Hs01_00077647 predicted 430
11 SASI_Hs01_00077642 predicted 312
12 SASI_Hs01_00077643 predicted 594
13 SASI_Hs01_00077644 predicted 428
14 SASI_Hs01_00077645 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030903
OR2W1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily W, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-628s1c1
Sequence:CCGGCCTCTCATCCTTATTCTTATACTCGAGTATAAGAATAAGGATGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-91s1c1
Sequence:CCGGGTCGCCATCTTCTACTTAATTCTCGAGAATTAAGTAGAAGATGGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-744s1c1
Sequence:CCGGGTCTATGTTCTATGGAACTATCTCGAGATAGTTCCATAGAACATAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-290s1c1
Sequence:CCGGGTATCATCCAACTCTATGTTTCTCGAGAAACATAGAGTTGGATGATACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-509s1c1
Sequence:CCGGGAAACAACATTCTGGATCATTCTCGAGAATGATCCAGAATGTTGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030903.3-458s21c1
Sequence:CCGGTGGCCAATTCTGTAGTATTATCTCGAGATAATACTACAGAATTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030903.3-435s21c1
Sequence:CCGGTATCATGATCTGGAGTATTAGCTCGAGCTAATACTCCAGATCATGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030903.3-92s21c1
Sequence:CCGGTCGCCATCTTCTACTTAATTACTCGAGTAATTAAGTAGAAGATGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030903
OR2W1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily W, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-628s1c1
Sequence:CCGGCCTCTCATCCTTATTCTTATACTCGAGTATAAGAATAAGGATGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-91s1c1
Sequence:CCGGGTCGCCATCTTCTACTTAATTCTCGAGAATTAAGTAGAAGATGGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-744s1c1
Sequence:CCGGGTCTATGTTCTATGGAACTATCTCGAGATAGTTCCATAGAACATAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-290s1c1
Sequence:CCGGGTATCATCCAACTCTATGTTTCTCGAGAAACATAGAGTTGGATGATACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-509s1c1
Sequence:CCGGGAAACAACATTCTGGATCATTCTCGAGAATGATCCAGAATGTTGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030903.3-458s21c1
Sequence:CCGGTGGCCAATTCTGTAGTATTATCTCGAGATAATACTACAGAATTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030903.3-435s21c1
Sequence:CCGGTATCATGATCTGGAGTATTAGCTCGAGCTAATACTCCAGATCATGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030903.3-92s21c1
Sequence:CCGGTCGCCATCTTCTACTTAATTACTCGAGTAATTAAGTAGAAGATGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030903
OR2W1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily W, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-628s1c1
Sequence:CCGGCCTCTCATCCTTATTCTTATACTCGAGTATAAGAATAAGGATGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-91s1c1
Sequence:CCGGGTCGCCATCTTCTACTTAATTCTCGAGAATTAAGTAGAAGATGGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-744s1c1
Sequence:CCGGGTCTATGTTCTATGGAACTATCTCGAGATAGTTCCATAGAACATAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-290s1c1
Sequence:CCGGGTATCATCCAACTCTATGTTTCTCGAGAAACATAGAGTTGGATGATACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030903.1-509s1c1
Sequence:CCGGGAAACAACATTCTGGATCATTCTCGAGAATGATCCAGAATGTTGTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030903.3-458s21c1
Sequence:CCGGTGGCCAATTCTGTAGTATTATCTCGAGATAATACTACAGAATTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030903.3-435s21c1
Sequence:CCGGTATCATGATCTGGAGTATTAGCTCGAGCTAATACTCCAGATCATGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030903.3-92s21c1
Sequence:CCGGTCGCCATCTTCTACTTAATTACTCGAGTAATTAAGTAGAAGATGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)