EMAIL THIS PAGE TO A FRIEND

OR2Y1

olfactory receptor, family 2, subfamily Y, member 1

16 Gene Product Result for
Synonyms: OR5-2
UniProtKB ID: Q8NGV0, B9EIP1, Q6IFB1, Q96R16
Gene ID:
Human(134083) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(788617) olfactory receptor, family 2, subfamily Y, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304206 ANTI-OR2Y1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4500416 Anti-OR2Y1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_068682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_068682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_068682 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001657 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024999 predicted 659
2 SASI_Hs01_00025000 predicted 624
3 SASI_Hs01_00025001 predicted 618
4 SASI_Hs01_00025002 predicted 637
5 SASI_Hs01_00025003 predicted 449
6 SASI_Hs01_00025005 predicted 593
7 SASI_Hs01_00025006 predicted 659
8 SASI_Hs01_00025007 predicted 618
9 SASI_Hs01_00025008 predicted 372
10 SASI_Hs02_00303852 predicted 494
11 SASI_Hs01_00025004 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_068682
OR2Y1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily Y, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000197315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_068682.4-295s1c2
Sequence:CCGGGCTCAGCTCTTCATCTACCTACTCGAGTAGGTAGATGAAGAGCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_068682.4-761s1c1
Sequence:CCGGCCATCTACACATATCTCCAATCTCGAGATTGGAGATATGTGTAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_068682.4-631s1c1
Sequence:CCGGGCACTTATTCTAGGCTCCTATCTCGAGATAGGAGCCTAGAATAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_068682
OR2Y1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily Y, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000197315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_068682.4-295s1c2
Sequence:CCGGGCTCAGCTCTTCATCTACCTACTCGAGTAGGTAGATGAAGAGCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_068682.4-761s1c1
Sequence:CCGGCCATCTACACATATCTCCAATCTCGAGATTGGAGATATGTGTAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_068682.4-631s1c1
Sequence:CCGGGCACTTATTCTAGGCTCCTATCTCGAGATAGGAGCCTAGAATAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_068682
OR2Y1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily Y, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000197315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_068682.4-295s1c2
Sequence:CCGGGCTCAGCTCTTCATCTACCTACTCGAGTAGGTAGATGAAGAGCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_068682.4-761s1c1
Sequence:CCGGCCATCTACACATATCTCCAATCTCGAGATTGGAGATATGTGTAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_068682.4-631s1c1
Sequence:CCGGGCACTTATTCTAGGCTCCTATCTCGAGATAGGAGCCTAGAATAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)