EMAIL THIS PAGE TO A FRIEND

OR3A1

olfactory receptor, family 3, subfamily A, member 1

17 Gene Product Result for
Synonyms: OLFRA03 OR17-40 OR17-82 OR40
UniProtKB ID: P47881, Q4VB06, Q6IFM4
Gene ID:
Human(4994) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(532454) olfactory receptor, family 3, subfamily A, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302685 ANTI-OR3A1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002550 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006751 MISSION® esiRNA esiRNA targeting human OR3A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002550 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109392 predicted 638
2 SASI_Hs01_00109393 predicted 253
3 SASI_Hs01_00109394 predicted 215
4 SASI_Hs01_00109395 predicted 308
5 SASI_Hs01_00109396 predicted 322
6 SASI_Hs01_00109397 predicted 689
7 SASI_Hs01_00109398 predicted 744
8 SASI_Hs01_00109399 predicted 793
9 SASI_Hs01_00109400 predicted 786
10 SASI_Hs01_00109401 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002550
OR3A1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 3, subfamily A, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-231s1c1
Sequence:CCGGCAGCGTCACTGTTCCATCAATCTCGAGATTGATGGAACAGTGACGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-755s1c1
Sequence:CCGGCCATATTCTATGGTTCAGGTACTCGAGTACCTGAACCATAGAATATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-643s1c1
Sequence:CCGGGCTCTCATTGTCATCTCCTATCTCGAGATAGGAGATGACAATGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-81s1c1
Sequence:CCGGGCCAGTTGTCTTTGTGCTCTTCTCGAGAAGAGCACAAAGACAACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-791s1c1
Sequence:CCGGGACTGGGTTCAACCAAGCTTTCTCGAGAAAGCTTGGTTGAACCCAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-639s21c1
Sequence:CCGGCATGGCTCTCATTGTCATCTCCTCGAGGAGATGACAATGAGAGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-232s21c1
Sequence:CCGGAGCGTCACTGTTCCATCAATGCTCGAGCATTGATGGAACAGTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-761s21c1
Sequence:CCGGTCTATGGTTCAGGTATCTTTACTCGAGTAAAGATACCTGAACCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-28s21c1
Sequence:CCGGACAGTCATTGCTGAGTTCATCCTCGAGGATGAACTCAGCAATGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002550
OR3A1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 3, subfamily A, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-231s1c1
Sequence:CCGGCAGCGTCACTGTTCCATCAATCTCGAGATTGATGGAACAGTGACGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-755s1c1
Sequence:CCGGCCATATTCTATGGTTCAGGTACTCGAGTACCTGAACCATAGAATATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-643s1c1
Sequence:CCGGGCTCTCATTGTCATCTCCTATCTCGAGATAGGAGATGACAATGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-81s1c1
Sequence:CCGGGCCAGTTGTCTTTGTGCTCTTCTCGAGAAGAGCACAAAGACAACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-791s1c1
Sequence:CCGGGACTGGGTTCAACCAAGCTTTCTCGAGAAAGCTTGGTTGAACCCAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-639s21c1
Sequence:CCGGCATGGCTCTCATTGTCATCTCCTCGAGGAGATGACAATGAGAGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-232s21c1
Sequence:CCGGAGCGTCACTGTTCCATCAATGCTCGAGCATTGATGGAACAGTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-761s21c1
Sequence:CCGGTCTATGGTTCAGGTATCTTTACTCGAGTAAAGATACCTGAACCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-28s21c1
Sequence:CCGGACAGTCATTGCTGAGTTCATCCTCGAGGATGAACTCAGCAATGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002550
OR3A1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 3, subfamily A, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-231s1c1
Sequence:CCGGCAGCGTCACTGTTCCATCAATCTCGAGATTGATGGAACAGTGACGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-755s1c1
Sequence:CCGGCCATATTCTATGGTTCAGGTACTCGAGTACCTGAACCATAGAATATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-643s1c1
Sequence:CCGGGCTCTCATTGTCATCTCCTATCTCGAGATAGGAGATGACAATGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-81s1c1
Sequence:CCGGGCCAGTTGTCTTTGTGCTCTTCTCGAGAAGAGCACAAAGACAACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002550.1-791s1c1
Sequence:CCGGGACTGGGTTCAACCAAGCTTTCTCGAGAAAGCTTGGTTGAACCCAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-639s21c1
Sequence:CCGGCATGGCTCTCATTGTCATCTCCTCGAGGAGATGACAATGAGAGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-232s21c1
Sequence:CCGGAGCGTCACTGTTCCATCAATGCTCGAGCATTGATGGAACAGTGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-761s21c1
Sequence:CCGGTCTATGGTTCAGGTATCTTTACTCGAGTAAAGATACCTGAACCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002550.1-28s21c1
Sequence:CCGGACAGTCATTGCTGAGTTCATCCTCGAGGATGAACTCAGCAATGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)