EMAIL THIS PAGE TO A FRIEND

OR3A2

olfactory receptor, family 3, subfamily A, member 2

20 Gene Product Result for
Synonyms: OLFRA04 OR17-14 OR17-228 OR228
UniProtKB ID: P47893, Q6IFM3, Q9P1Q3
Gene ID:
Human(4995) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(491211) olfactory receptor, family 3, subfamily A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502052 Anti-OR3A2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002551 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002551 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237767 predicted 683
2 SASI_Hs01_00237768 predicted 307
3 SASI_Hs01_00237769 predicted 735
4 SASI_Hs01_00237770 predicted 745
5 SASI_Hs01_00237772 predicted 816
6 SASI_Hs02_00334039 predicted 270
7 SASI_Hs01_00237773 predicted 855
8 SASI_Hs02_00334040 predicted 284
9 SASI_Hs02_00334041 predicted 748
10 SASI_Hs02_00334042 predicted 256
11 SASI_Hs01_00237766 predicted 828
12 SASI_Hs01_00237771 predicted 540
13 SASI_Hs01_00237774 predicted 665
14 SASI_Hs01_00237775 predicted 555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002551
OR3A2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 3, subfamily A, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-826s21c1
Sequence:CCGGAGAGGTATCTTCAACTACATGCTCGAGCATGTAGTTGAAGATACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-900s21c1
Sequence:CCGGCACTGTTATCAACCCTATGCTCTCGAGAGCATAGGGTTGATAACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-860s21c1
Sequence:CCGGAGGAGGCTTCAGACAAGGATACTCGAGTATCCTTGTCTGAAGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-753s21c1
Sequence:CCGGTTCAGTGGAGGGCCGAAAGAACTCGAGTTCTTTCGGCCCTCCACTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-679s21c1
Sequence:CCGGATCATGGCAGGCACACCTTTGCTCGAGCAAAGGTGTGCCTGCCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-713s1c1
Sequence:CCGGCCACAAGTCCACAATTTCCTACTCGAGTAGGAAATTGTGGACTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-1073s1c1
Sequence:CCGGAGGCACACCTTTGGTTCTCATCTCGAGATGAGAACCAAAGGTGTGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-594s1c1
Sequence:CCGGGCCGTCTTGGTGGAGCCCAAACTCGAGTTTGGGCTCCACCAAGACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-1205s1c1
Sequence:CCGGCTTTGGAAGAGGTATCTTCAACTCGAGTTGAAGATACCTCTTCCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-1120s1c1
Sequence:CCGGCTGCAGTTCTACGAATCCGTTCTCGAGAACGGATTCGTAGAACTGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002551
OR3A2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 3, subfamily A, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-826s21c1
Sequence:CCGGAGAGGTATCTTCAACTACATGCTCGAGCATGTAGTTGAAGATACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-900s21c1
Sequence:CCGGCACTGTTATCAACCCTATGCTCTCGAGAGCATAGGGTTGATAACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-860s21c1
Sequence:CCGGAGGAGGCTTCAGACAAGGATACTCGAGTATCCTTGTCTGAAGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-753s21c1
Sequence:CCGGTTCAGTGGAGGGCCGAAAGAACTCGAGTTCTTTCGGCCCTCCACTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-679s21c1
Sequence:CCGGATCATGGCAGGCACACCTTTGCTCGAGCAAAGGTGTGCCTGCCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-713s1c1
Sequence:CCGGCCACAAGTCCACAATTTCCTACTCGAGTAGGAAATTGTGGACTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-1073s1c1
Sequence:CCGGAGGCACACCTTTGGTTCTCATCTCGAGATGAGAACCAAAGGTGTGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-594s1c1
Sequence:CCGGGCCGTCTTGGTGGAGCCCAAACTCGAGTTTGGGCTCCACCAAGACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-1205s1c1
Sequence:CCGGCTTTGGAAGAGGTATCTTCAACTCGAGTTGAAGATACCTCTTCCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-1120s1c1
Sequence:CCGGCTGCAGTTCTACGAATCCGTTCTCGAGAACGGATTCGTAGAACTGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002551
OR3A2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 3, subfamily A, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-826s21c1
Sequence:CCGGAGAGGTATCTTCAACTACATGCTCGAGCATGTAGTTGAAGATACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-900s21c1
Sequence:CCGGCACTGTTATCAACCCTATGCTCTCGAGAGCATAGGGTTGATAACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-860s21c1
Sequence:CCGGAGGAGGCTTCAGACAAGGATACTCGAGTATCCTTGTCTGAAGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-753s21c1
Sequence:CCGGTTCAGTGGAGGGCCGAAAGAACTCGAGTTCTTTCGGCCCTCCACTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002551.3-679s21c1
Sequence:CCGGATCATGGCAGGCACACCTTTGCTCGAGCAAAGGTGTGCCTGCCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-713s1c1
Sequence:CCGGCCACAAGTCCACAATTTCCTACTCGAGTAGGAAATTGTGGACTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-1073s1c1
Sequence:CCGGAGGCACACCTTTGGTTCTCATCTCGAGATGAGAACCAAAGGTGTGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-594s1c1
Sequence:CCGGGCCGTCTTGGTGGAGCCCAAACTCGAGTTTGGGCTCCACCAAGACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-1205s1c1
Sequence:CCGGCTTTGGAAGAGGTATCTTCAACTCGAGTTGAAGATACCTCTTCCAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002551.2-1120s1c1
Sequence:CCGGCTGCAGTTCTACGAATCCGTTCTCGAGAACGGATTCGTAGAACTGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)