EMAIL THIS PAGE TO A FRIEND

OR4A15

olfactory receptor, family 4, subfamily A, member 15

14 Gene Product Result for
Synonyms: OR11-118
UniProtKB ID: Q8NGL6, Q6IFL4, Q96R65
Gene ID:
Human(81328) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(511653) olfactory receptor, family 4, subfamily A, member 15
dog(483591) cOR4A26 olfactory receptor family 4 subfamily A-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304373 ANTI-OR4A15 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4503231 Anti-OR4A15 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005275 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005275 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086080 predicted 691
2 SASI_Hs01_00086081 predicted 294
3 SASI_Hs01_00086082 predicted 764
4 SASI_Hs01_00086083 predicted 613
5 SASI_Hs01_00086084 predicted 653
6 SASI_Hs01_00086085 predicted 733
7 SASI_Hs01_00086086 predicted 416
8 SASI_Hs01_00086087 predicted 746
9 SASI_Hs01_00086088 predicted 327
10 SASI_Hs01_00086089 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005275
OR4A15 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily A, member 15
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000203392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005275.1-76s1c1
Sequence:CCGGCCTTCAGAAGAACACATGAAACTCGAGTTTCATGTGTTCTTCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005275.1-284s1c1
Sequence:CCGGCATTCATAGATACCGTCTATTCTCGAGAATAGACGGTATCTATGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005275.1-356s1c1
Sequence:CCGGCCATTTCCTTTCAGGGTTGTACTCGAGTACAACCCTGAAAGGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005275
OR4A15 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily A, member 15
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000203392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005275.1-76s1c1
Sequence:CCGGCCTTCAGAAGAACACATGAAACTCGAGTTTCATGTGTTCTTCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005275.1-284s1c1
Sequence:CCGGCATTCATAGATACCGTCTATTCTCGAGAATAGACGGTATCTATGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005275.1-356s1c1
Sequence:CCGGCCATTTCCTTTCAGGGTTGTACTCGAGTACAACCCTGAAAGGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005275
OR4A15 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily A, member 15
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000203392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005275.1-76s1c1
Sequence:CCGGCCTTCAGAAGAACACATGAAACTCGAGTTTCATGTGTTCTTCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005275.1-284s1c1
Sequence:CCGGCATTCATAGATACCGTCTATTCTCGAGAATAGACGGTATCTATGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005275.1-356s1c1
Sequence:CCGGCCATTTCCTTTCAGGGTTGTACTCGAGTACAACCCTGAAAGGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)