EMAIL THIS PAGE TO A FRIEND

OR4C11

olfactory receptor, family 4, subfamily C, member 11

15 Gene Product Result for
Synonyms: OR11-136 OR4C11P
Species: Human OR4C11(219429)
UniProtKB ID: Q6IEV9, B9EIL4, Q8NGL8
Gene ID:
Human(219429) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004700 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004700 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304651 predicted 582
2 SASI_Hs02_00304652 predicted 614
3 SASI_Hs01_00240338 predicted 495
4 SASI_Hs01_00240339 predicted 338
5 SASI_Hs01_00240340 predicted 319
6 SASI_Hs01_00240341 predicted 641
7 SASI_Hs01_00240342 predicted 225
8 SASI_Hs01_00240344 predicted 488
9 SASI_Hs02_00304653 predicted 645
10 SASI_Hs01_00240345 predicted 275
11 SASI_Hs01_00240336 predicted 446
12 SASI_Hs01_00240337 predicted 467
13 SASI_Hs01_00240343 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004700
OR4C11 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily C, member 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-466s1c1
Sequence:CCGGGCTCAGATTATCCTGGCCTTACTCGAGTAAGGCCAGGATAATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-436s1c1
Sequence:CCGGGCCTGGATAGGGTCTTTAATACTCGAGTATTAAAGACCCTATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-614s1c1
Sequence:CCGGGCTCAAGTAGTTTCATGATTTCTCGAGAAATCATGAAACTACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-290s1c1
Sequence:CCGGCACAAGTCTTTGCACTACATTCTCGAGAATGTAGTGCAAAGACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-708s1c1
Sequence:CCGGCGCTTGCACGTCTCACATAATCTCGAGATTATGTGAGACGTGCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004700.1-27s21c1
Sequence:CCGGATTCATACTGTTAGGATTAACCTCGAGGTTAATCCTAACAGTATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004700.1-504s21c1
Sequence:CCGGACCCTATTTGATTGATCATTACTCGAGTAATGATCAATCAAATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004700.1-433s21c1
Sequence:CCGGCTTGCCTGGATAGGGTCTTTACTCGAGTAAAGACCCTATCCAGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004700
OR4C11 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily C, member 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-466s1c1
Sequence:CCGGGCTCAGATTATCCTGGCCTTACTCGAGTAAGGCCAGGATAATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-436s1c1
Sequence:CCGGGCCTGGATAGGGTCTTTAATACTCGAGTATTAAAGACCCTATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-614s1c1
Sequence:CCGGGCTCAAGTAGTTTCATGATTTCTCGAGAAATCATGAAACTACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-290s1c1
Sequence:CCGGCACAAGTCTTTGCACTACATTCTCGAGAATGTAGTGCAAAGACTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-708s1c1
Sequence:CCGGCGCTTGCACGTCTCACATAATCTCGAGATTATGTGAGACGTGCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004700.1-27s21c1
Sequence:CCGGATTCATACTGTTAGGATTAACCTCGAGGTTAATCCTAACAGTATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004700.1-504s21c1
Sequence:CCGGACCCTATTTGATTGATCATTACTCGAGTAATGATCAATCAAATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004700.1-433s21c1
Sequence:CCGGCTTGCCTGGATAGGGTCTTTACTCGAGTAAAGACCCTATCCAGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004700
OR4C11 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily C, member 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-466s1c1
Sequence:CCGGGCTCAGATTATCCTGGCCTTACTCGAGTAAGGCCAGGATAATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-436s1c1
Sequence:CCGGGCCTGGATAGGGTCTTTAATACTCGAGTATTAAAGACCCTATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-614s1c1
Sequence:CCGGGCTCAAGTAGTTTCATGATTTCTCGAGAAATCATGAAACTACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-290s1c1
Sequence:CCGGCACAAGTCTTTGCACTACATTCTCGAGAATGTAGTGCAAAGACTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004700.1-708s1c1
Sequence:CCGGCGCTTGCACGTCTCACATAATCTCGAGATTATGTGAGACGTGCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004700.1-27s21c1
Sequence:CCGGATTCATACTGTTAGGATTAACCTCGAGGTTAATCCTAACAGTATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004700.1-504s21c1
Sequence:CCGGACCCTATTTGATTGATCATTACTCGAGTAATGATCAATCAAATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004700.1-433s21c1
Sequence:CCGGCTTGCCTGGATAGGGTCTTTACTCGAGTAAAGACCCTATCCAGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)