EMAIL THIS PAGE TO A FRIEND

OR4C12

olfactory receptor, family 4, subfamily C, member 12

15 Gene Product Result for
Synonyms: OR11-259
UniProtKB ID: Q96R67, B2RNF0, Q6IF49
Gene ID:
Human(283093) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(781435) olfactory receptor, family 4, subfamily C, member 12
dog(483604) cOR4C24 olfactory receptor family 4 subfamily C-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304041 ANTI-OR4C12 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4501234 Anti-OR4C12 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_210169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_210169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_210169 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005270 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198157 predicted 641
2 SASI_Hs01_00198158 predicted 221
3 SASI_Hs01_00198159 predicted 527
4 SASI_Hs01_00198160 predicted 452
5 SASI_Hs01_00198161 predicted 568
6 SASI_Hs01_00198162 predicted 443
7 SASI_Hs01_00198163 predicted 461
8 SASI_Hs01_00198164 predicted 602
9 SASI_Hs01_00198165 predicted 554
10 SASI_Hs02_00304813 predicted 206
11 SASI_Hs01_00198166 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_210169
OR4C12 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily C, member 12
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-721s1c1
Sequence:CCGGCACATCATAGTAGTTGTCTTACTCGAGTAAGACAACTACTATGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-519s1c1
Sequence:CCGGCCACTTCATGTGTGACTTGTACTCGAGTACAAGTCACACATGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-460s1c1
Sequence:CCGGGCAACTATTCAGATTCTCTTTCTCGAGAAAGAGAATCTGAATAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-379s1c1
Sequence:CCGGCCTCTGAACTACACAACCATTCTCGAGAATGGTTGTGTAGTTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_210169
OR4C12 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily C, member 12
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-721s1c1
Sequence:CCGGCACATCATAGTAGTTGTCTTACTCGAGTAAGACAACTACTATGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-519s1c1
Sequence:CCGGCCACTTCATGTGTGACTTGTACTCGAGTACAAGTCACACATGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-460s1c1
Sequence:CCGGGCAACTATTCAGATTCTCTTTCTCGAGAAAGAGAATCTGAATAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-379s1c1
Sequence:CCGGCCTCTGAACTACACAACCATTCTCGAGAATGGTTGTGTAGTTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_210169
OR4C12 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily C, member 12
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-721s1c1
Sequence:CCGGCACATCATAGTAGTTGTCTTACTCGAGTAAGACAACTACTATGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-519s1c1
Sequence:CCGGCCACTTCATGTGTGACTTGTACTCGAGTACAAGTCACACATGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-460s1c1
Sequence:CCGGGCAACTATTCAGATTCTCTTTCTCGAGAAAGAGAATCTGAATAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210169.2-379s1c1
Sequence:CCGGCCTCTGAACTACACAACCATTCTCGAGAATGGTTGTGTAGTTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)