EMAIL THIS PAGE TO A FRIEND

OR4C15

olfactory receptor, family 4, subfamily C, member 15

17 Gene Product Result for
Synonyms: OR11-127 OR11-134
UniProtKB ID: Q8NGM1, Q6IFE2
Gene ID:
Human(81309) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(522410) olfactory receptor, family 4, subfamily C, member 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001920 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001920 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182770 predicted 815
2 SASI_Hs01_00182771 predicted 786
3 SASI_Hs01_00182772 predicted 791
4 SASI_Hs01_00182773 predicted 762
5 SASI_Hs01_00182774 predicted 272
6 SASI_Hs01_00182775 predicted 193
7 SASI_Hs01_00182776 predicted 719
8 SASI_Hs02_00303995 predicted 806
9 SASI_Hs01_00182777 predicted 836
10 SASI_Hs02_00303996 predicted 281
11 SASI_Hs01_00182778 predicted 547
12 SASI_Hs01_00182779 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001920
OR4C15 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily C, member 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-47s1c1
Sequence:CCGGGTACCAACTTGTTAATGACTACTCGAGTAGTCATTAACAAGTTGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-546s1c1
Sequence:CCGGCTTGCATTACTCTTCTATCATCTCGAGATGATAGAAGAGTAATGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-278s1c1
Sequence:CCGGGCAACATGCTAATTGTAGTAACTCGAGTTACTACAATTAGCATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-99s1c1
Sequence:CCGGCCTTTGTCCTAATTGCAGACTCTCGAGAGTCTGCAATTAGGACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-100s1c1
Sequence:CCGGCTTTGTCCTAATTGCAGACTACTCGAGTAGTCTGCAATTAGGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001920
OR4C15 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily C, member 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-47s1c1
Sequence:CCGGGTACCAACTTGTTAATGACTACTCGAGTAGTCATTAACAAGTTGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-546s1c1
Sequence:CCGGCTTGCATTACTCTTCTATCATCTCGAGATGATAGAAGAGTAATGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-278s1c1
Sequence:CCGGGCAACATGCTAATTGTAGTAACTCGAGTTACTACAATTAGCATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-99s1c1
Sequence:CCGGCCTTTGTCCTAATTGCAGACTCTCGAGAGTCTGCAATTAGGACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-100s1c1
Sequence:CCGGCTTTGTCCTAATTGCAGACTACTCGAGTAGTCTGCAATTAGGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001920
OR4C15 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily C, member 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-47s1c1
Sequence:CCGGGTACCAACTTGTTAATGACTACTCGAGTAGTCATTAACAAGTTGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-546s1c1
Sequence:CCGGCTTGCATTACTCTTCTATCATCTCGAGATGATAGAAGAGTAATGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-278s1c1
Sequence:CCGGGCAACATGCTAATTGTAGTAACTCGAGTTACTACAATTAGCATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-99s1c1
Sequence:CCGGCCTTTGTCCTAATTGCAGACTCTCGAGAGTCTGCAATTAGGACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001920.1-100s1c1
Sequence:CCGGCTTTGTCCTAATTGCAGACTACTCGAGTAGTCTGCAATTAGGACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)