EMAIL THIS PAGE TO A FRIEND

OR4D11

olfactory receptor, family 4, subfamily D, member 11

14 Gene Product Result for
Synonyms: OR4D11P
UniProtKB ID: Q8NGI4
Gene ID:
Human(219986) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(788627) olfactory receptor, family 4, subfamily D, member 11
dog(483450) olfactory receptor, family 4, subfamily D, member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302087 ANTI-OR4D11 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004706 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004706 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113367 predicted 216
2 SASI_Hs01_00113368 predicted 572
3 SASI_Hs01_00113370 predicted 644
4 SASI_Hs01_00113371 predicted 580
5 SASI_Hs01_00113372 predicted 606
6 SASI_Hs01_00113373 predicted 287
7 SASI_Hs01_00113374 predicted 238
8 SASI_Hs01_00113375 predicted 609
9 SASI_Hs01_00113376 predicted 223
10 SASI_Hs02_00304657 predicted 406
11 SASI_Hs01_00113369 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004706
OR4D11 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily D, member 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-580s1c1
Sequence:CCGGGCTCTTGAGTTCTTGATGATTCTCGAGAATCATCAAGAACTCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-291s1c1
Sequence:CCGGCATGACACAGATATTTCTCTTCTCGAGAAGAGAAATATCTGTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-64s1c1
Sequence:CCGGGACCAGAGTTTGGTCTTGTTTCTCGAGAAACAAGACCAAACTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-642s1c1
Sequence:CCGGGCTTGTGTCCTACACAGTCATCTCGAGATGACTGTGTAGGACACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-235s1c1
Sequence:CCGGCCTAAAGTCTTGCTGGACCTTCTCGAGAAGGTCCAGCAAGACTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004706
OR4D11 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily D, member 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-580s1c1
Sequence:CCGGGCTCTTGAGTTCTTGATGATTCTCGAGAATCATCAAGAACTCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-291s1c1
Sequence:CCGGCATGACACAGATATTTCTCTTCTCGAGAAGAGAAATATCTGTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-64s1c1
Sequence:CCGGGACCAGAGTTTGGTCTTGTTTCTCGAGAAACAAGACCAAACTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-642s1c1
Sequence:CCGGGCTTGTGTCCTACACAGTCATCTCGAGATGACTGTGTAGGACACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-235s1c1
Sequence:CCGGCCTAAAGTCTTGCTGGACCTTCTCGAGAAGGTCCAGCAAGACTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004706
OR4D11 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily D, member 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-580s1c1
Sequence:CCGGGCTCTTGAGTTCTTGATGATTCTCGAGAATCATCAAGAACTCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-291s1c1
Sequence:CCGGCATGACACAGATATTTCTCTTCTCGAGAAGAGAAATATCTGTGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-64s1c1
Sequence:CCGGGACCAGAGTTTGGTCTTGTTTCTCGAGAAACAAGACCAAACTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-642s1c1
Sequence:CCGGGCTTGTGTCCTACACAGTCATCTCGAGATGACTGTGTAGGACACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004706.1-235s1c1
Sequence:CCGGCCTAAAGTCTTGCTGGACCTTCTCGAGAAGGTCCAGCAAGACTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)