EMAIL THIS PAGE TO A FRIEND

OR4D1

olfactory receptor, family 4, subfamily D, member 1

15 Gene Product Result for
Synonyms: OR17-23 OR4D3 OR4D4P TPCR16
UniProtKB ID: Q15615, B2RN14, Q8NGB1, Q96R76
Gene ID:
Human(26689) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(609961) olfactory receptor, family 4, subfamily D, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501159 Anti-OR4D1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012374 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150071 MISSION® esiRNA esiRNA human OR4D1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012374 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117148 predicted 387
2 SASI_Hs01_00117149 predicted 387
3 SASI_Hs01_00117150 predicted 643
4 SASI_Hs01_00117151 predicted 228
5 SASI_Hs01_00117152 predicted 280
6 SASI_Hs01_00117154 predicted 600
7 SASI_Hs01_00117155 predicted 604
8 SASI_Hs01_00117156 predicted 392
9 SASI_Hs01_00117157 predicted 483
10 SASI_Hs02_00344171 predicted 229
11 SASI_Hs01_00117153 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012374
OR4D1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily D, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-188s21c1
Sequence:CCGGTCCGAAATCTAGCTCTCATAGCTCGAGCTATGAGAGCTAGATTTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-86s21c1
Sequence:CCGGTTCTGTTCCTGTTAGTCTATGCTCGAGCATAGACTAACAGGAACAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-635s21c1
Sequence:CCGGTCCTCCTTCTGATCTCTTATACTCGAGTATAAGAGATCAGAAGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-743s1c1
Sequence:CCGGCCATGATCTTCATTCCCTGTACTCGAGTACAGGGAATGAAGATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-603s21c1
Sequence:CCGGCAACAGTGGGCTGCTAGTTATCTCGAGATAACTAGCAGCCCACTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-199s1c1
Sequence:CCGGGCTCTCATAGACCTCTGCTATCTCGAGATAGCAGAGGTCTATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-186s1c1
Sequence:CCGGGCTCCGAAATCTAGCTCTCATCTCGAGATGAGAGCTAGATTTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-612s1c1
Sequence:CCGGGCTGCTAGTTATCATCTGGTTCTCGAGAACCAGATGATAACTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-633s1c1
Sequence:CCGGCCTCCTCCTTCTGATCTCTTACTCGAGTAAGAGATCAGAAGGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012374
OR4D1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily D, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-188s21c1
Sequence:CCGGTCCGAAATCTAGCTCTCATAGCTCGAGCTATGAGAGCTAGATTTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-86s21c1
Sequence:CCGGTTCTGTTCCTGTTAGTCTATGCTCGAGCATAGACTAACAGGAACAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-635s21c1
Sequence:CCGGTCCTCCTTCTGATCTCTTATACTCGAGTATAAGAGATCAGAAGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-743s1c1
Sequence:CCGGCCATGATCTTCATTCCCTGTACTCGAGTACAGGGAATGAAGATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-603s21c1
Sequence:CCGGCAACAGTGGGCTGCTAGTTATCTCGAGATAACTAGCAGCCCACTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-199s1c1
Sequence:CCGGGCTCTCATAGACCTCTGCTATCTCGAGATAGCAGAGGTCTATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-186s1c1
Sequence:CCGGGCTCCGAAATCTAGCTCTCATCTCGAGATGAGAGCTAGATTTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-612s1c1
Sequence:CCGGGCTGCTAGTTATCATCTGGTTCTCGAGAACCAGATGATAACTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-633s1c1
Sequence:CCGGCCTCCTCCTTCTGATCTCTTACTCGAGTAAGAGATCAGAAGGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012374
OR4D1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily D, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-188s21c1
Sequence:CCGGTCCGAAATCTAGCTCTCATAGCTCGAGCTATGAGAGCTAGATTTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-86s21c1
Sequence:CCGGTTCTGTTCCTGTTAGTCTATGCTCGAGCATAGACTAACAGGAACAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-635s21c1
Sequence:CCGGTCCTCCTTCTGATCTCTTATACTCGAGTATAAGAGATCAGAAGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-743s1c1
Sequence:CCGGCCATGATCTTCATTCCCTGTACTCGAGTACAGGGAATGAAGATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012374.1-603s21c1
Sequence:CCGGCAACAGTGGGCTGCTAGTTATCTCGAGATAACTAGCAGCCCACTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-199s1c1
Sequence:CCGGGCTCTCATAGACCTCTGCTATCTCGAGATAGCAGAGGTCTATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-186s1c1
Sequence:CCGGGCTCCGAAATCTAGCTCTCATCTCGAGATGAGAGCTAGATTTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-612s1c1
Sequence:CCGGGCTGCTAGTTATCATCTGGTTCTCGAGAACCAGATGATAACTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012374.1-633s1c1
Sequence:CCGGCCTCCTCCTTCTGATCTCTTACTCGAGTAAGAGATCAGAAGGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)