EMAIL THIS PAGE TO A FRIEND

OR4D2

olfactory receptor, family 4, subfamily D, member 2

21 Gene Product Result for
Synonyms: BC2009 OR17-24
UniProtKB ID: P58180, Q6IFN8, Q96R75
Gene ID:
Human(124538) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(514319) olfactory receptor, family 4, subfamily D, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302203 ANTI-OR4D2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_064177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_064177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_064177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004707 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136101 MISSION® esiRNA esiRNA human OR4D2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004707 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304658 predicted 445
2 SASI_Hs02_00304659 predicted 384
3 SASI_Hs02_00304660 predicted 387
4 SASI_Hs02_00304661 predicted 662
5 SASI_Hs01_00246413 predicted 647
6 SASI_Hs01_00246414 predicted 400
7 SASI_Hs02_00304662 predicted 283
8 SASI_Hs01_00246416 predicted 640
9 SASI_Hs02_00304663 predicted 317
10 SASI_Hs02_00304664 predicted 345
11 SASI_Hs01_00246407 predicted 1245
12 SASI_Hs01_00246408 predicted 1001
13 SASI_Hs01_00246409 predicted 354
14 SASI_Hs01_00246410 predicted 1208
15 SASI_Hs01_00246411 predicted 378
16 SASI_Hs01_00246412 predicted 1285
17 SASI_Hs01_00246415 predicted 1178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_064177
OR4D2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily D, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-429s1c1
Sequence:CCGGCATGTACTTTCTGCTCCGAAACTCGAGTTTCGGAGCAGAAAGTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-333s1c1
Sequence:CCGGCCTGTTTCTAATGTTCCTGTTCTCGAGAACAGGAACATTAGAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-894s1c1
Sequence:CCGGCCTCCTGATGTCCTACTTATTCTCGAGAATAAGTAGGACATCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-1008s1c2
Sequence:CCGGCGTTCCAAGCATTTACCTCTACTCGAGTAGAGGTAAATGCTTGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-897s1c1
Sequence:CCGGCCTGATGTCCTACTTATTCATCTCGAGATGAATAAGTAGGACATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_064177.4-1600s1c1
Sequence:CCGGCCCATCATTGACCAAACTGATCTCGAGATCAGTTTGGTCAATGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-428s1c1
Sequence:CCGGCCATGTACTTTCTGCTCCGAACTCGAGTTCGGAGCAGAAAGTACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_064177
OR4D2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily D, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-429s1c1
Sequence:CCGGCATGTACTTTCTGCTCCGAAACTCGAGTTTCGGAGCAGAAAGTACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-333s1c1
Sequence:CCGGCCTGTTTCTAATGTTCCTGTTCTCGAGAACAGGAACATTAGAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-894s1c1
Sequence:CCGGCCTCCTGATGTCCTACTTATTCTCGAGAATAAGTAGGACATCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-1008s1c2
Sequence:CCGGCGTTCCAAGCATTTACCTCTACTCGAGTAGAGGTAAATGCTTGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-897s1c1
Sequence:CCGGCCTGATGTCCTACTTATTCATCTCGAGATGAATAAGTAGGACATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_064177.4-1600s1c1
Sequence:CCGGCCCATCATTGACCAAACTGATCTCGAGATCAGTTTGGTCAATGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-428s1c1
Sequence:CCGGCCATGTACTTTCTGCTCCGAACTCGAGTTCGGAGCAGAAAGTACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_064177
OR4D2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily D, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-429s1c1
Sequence:CCGGCATGTACTTTCTGCTCCGAAACTCGAGTTTCGGAGCAGAAAGTACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-333s1c1
Sequence:CCGGCCTGTTTCTAATGTTCCTGTTCTCGAGAACAGGAACATTAGAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-894s1c1
Sequence:CCGGCCTCCTGATGTCCTACTTATTCTCGAGAATAAGTAGGACATCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-1008s1c2
Sequence:CCGGCGTTCCAAGCATTTACCTCTACTCGAGTAGAGGTAAATGCTTGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-897s1c1
Sequence:CCGGCCTGATGTCCTACTTATTCATCTCGAGATGAATAAGTAGGACATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203803    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_064177.4-1600s1c1
Sequence:CCGGCCCATCATTGACCAAACTGATCTCGAGATCAGTTTGGTCAATGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064177.4-428s1c1
Sequence:CCGGCCATGTACTTTCTGCTCCGAACTCGAGTTCGGAGCAGAAAGTACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004707
OR4D2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily D, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-359s21c1
Sequence:CCGGTTGACCGCCTCATTGCCATCTCTCGAGAGATGGCAATGAGGCGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-616s21c1
Sequence:CCGGCTGGATGTCGTCTGGTTCTTCCTCGAGGAAGAACCAGACGACATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-99s21c1
Sequence:CCGGTGTCTACATCACCACTGTTATCTCGAGATAACAGTGGTGATGTAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-747s21c1
Sequence:CCGGGATCTTCGTTCCAAGCATTTACTCGAGTAAATGCTTGGAACGAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-578s21c1
Sequence:CCGGCACTGCTGGAGTTCCTCAAGACTCGAGTCTTGAGGAACTCCAGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-638s21c1
Sequence:CCGGTCCTCCTGATGTCCTACTTATCTCGAGATAAGTAGGACATCAGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-449s21c1
Sequence:CCGGTGGGAGGCTTTGTCCACTCTACTCGAGTAGAGTGGACAAAGCCTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-138s21c1
Sequence:CCGGCATCACAGTGACCTCTGATTCCTCGAGGAATCAGAGGTCACTGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-665s21c1
Sequence:CCGGTGGTGATGCTGAGGTCACATCCTCGAGGATGTGACCTCAGCATCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004707
OR4D2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily D, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-359s21c1
Sequence:CCGGTTGACCGCCTCATTGCCATCTCTCGAGAGATGGCAATGAGGCGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-616s21c1
Sequence:CCGGCTGGATGTCGTCTGGTTCTTCCTCGAGGAAGAACCAGACGACATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-99s21c1
Sequence:CCGGTGTCTACATCACCACTGTTATCTCGAGATAACAGTGGTGATGTAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-747s21c1
Sequence:CCGGGATCTTCGTTCCAAGCATTTACTCGAGTAAATGCTTGGAACGAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-578s21c1
Sequence:CCGGCACTGCTGGAGTTCCTCAAGACTCGAGTCTTGAGGAACTCCAGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-638s21c1
Sequence:CCGGTCCTCCTGATGTCCTACTTATCTCGAGATAAGTAGGACATCAGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-449s21c1
Sequence:CCGGTGGGAGGCTTTGTCCACTCTACTCGAGTAGAGTGGACAAAGCCTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-138s21c1
Sequence:CCGGCATCACAGTGACCTCTGATTCCTCGAGGAATCAGAGGTCACTGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-665s21c1
Sequence:CCGGTGGTGATGCTGAGGTCACATCCTCGAGGATGTGACCTCAGCATCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004707
OR4D2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily D, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-359s21c1
Sequence:CCGGTTGACCGCCTCATTGCCATCTCTCGAGAGATGGCAATGAGGCGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-616s21c1
Sequence:CCGGCTGGATGTCGTCTGGTTCTTCCTCGAGGAAGAACCAGACGACATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-99s21c1
Sequence:CCGGTGTCTACATCACCACTGTTATCTCGAGATAACAGTGGTGATGTAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-747s21c1
Sequence:CCGGGATCTTCGTTCCAAGCATTTACTCGAGTAAATGCTTGGAACGAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-578s21c1
Sequence:CCGGCACTGCTGGAGTTCCTCAAGACTCGAGTCTTGAGGAACTCCAGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-638s21c1
Sequence:CCGGTCCTCCTGATGTCCTACTTATCTCGAGATAAGTAGGACATCAGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-449s21c1
Sequence:CCGGTGGGAGGCTTTGTCCACTCTACTCGAGTAGAGTGGACAAAGCCTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-138s21c1
Sequence:CCGGCATCACAGTGACCTCTGATTCCTCGAGGAATCAGAGGTCACTGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004707.3-665s21c1
Sequence:CCGGTGGTGATGCTGAGGTCACATCCTCGAGGATGTGACCTCAGCATCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)