EMAIL THIS PAGE TO A FRIEND

OR4D6

olfactory receptor, family 4, subfamily D, member 6

17 Gene Product Result for
Synonyms: OR11-250
UniProtKB ID: Q8NGJ1, B2RNP7, Q6IFF5, Q96R74
Gene ID:
Human(219983) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(615998) olfactory receptor, family 4, subfamily D, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166900 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139361 MISSION® esiRNA esiRNA human OR4D6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004708 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135864 predicted 572
2 SASI_Hs01_00135865 predicted 227
3 SASI_Hs01_00135866 predicted 648
4 SASI_Hs01_00135867 predicted 271
5 SASI_Hs01_00135868 predicted 510
6 SASI_Hs01_00135869 predicted 517
7 SASI_Hs02_00304665 predicted 444
8 SASI_Hs01_00135872 predicted 348
9 SASI_Hs01_00135873 predicted 532
10 SASI_Hs02_00304666 predicted 723
11 SASI_Hs01_00135870 predicted 290
12 SASI_Hs01_00135871 predicted 472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166900
OR4D6 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily D, member 6
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000188643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166900.3-106s1c1
Sequence:CCGGGTAGCAACAGTCCTGGGAAATCTCGAGATTTCCCAGGACTGTTGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166900.3-462s1c1
Sequence:CCGGGCATTCAATCATCCAGGTAATCTCGAGATTACCTGGATGATTGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166900.3-745s1c1
Sequence:CCGGCTTCACTTCGTGCCTTGTGTTCTCGAGAACACAAGGCACGAAGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166900
OR4D6 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily D, member 6
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000188643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166900.3-106s1c1
Sequence:CCGGGTAGCAACAGTCCTGGGAAATCTCGAGATTTCCCAGGACTGTTGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166900.3-462s1c1
Sequence:CCGGGCATTCAATCATCCAGGTAATCTCGAGATTACCTGGATGATTGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166900.3-745s1c1
Sequence:CCGGCTTCACTTCGTGCCTTGTGTTCTCGAGAACACAAGGCACGAAGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166900
OR4D6 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily D, member 6
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000188643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166900.3-106s1c1
Sequence:CCGGGTAGCAACAGTCCTGGGAAATCTCGAGATTTCCCAGGACTGTTGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166900.3-462s1c1
Sequence:CCGGGCATTCAATCATCCAGGTAATCTCGAGATTACCTGGATGATTGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166900.3-745s1c1
Sequence:CCGGCTTCACTTCGTGCCTTGTGTTCTCGAGAACACAAGGCACGAAGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)