EMAIL THIS PAGE TO A FRIEND

OR4E2

olfactory receptor, family 4, subfamily E, member 2

14 Gene Product Result for
Synonyms: OR14-42
UniProtKB ID: Q8NGC2, Q6IET6, Q96R62
Gene ID:
Human(26686) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(513435) olfactory receptor, family 4, subfamily E, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501158 Anti-OR4E2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001912 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001912 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129876 predicted 607
2 SASI_Hs01_00129877 predicted 412
3 SASI_Hs02_00303986 predicted 469
4 SASI_Hs01_00129878 predicted 471
5 SASI_Hs01_00129879 predicted 528
6 SASI_Hs01_00129881 predicted 640
7 SASI_Hs01_00129882 predicted 235
8 SASI_Hs01_00129883 predicted 561
9 SASI_Hs01_00129884 predicted 577
10 SASI_Hs01_00129885 predicted 645
11 SASI_Hs01_00129880 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001912
OR4E2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily E, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-587s1c1
Sequence:CCGGGAATACTGATTGTGACCAATACTCGAGTATTGGTCACAATCAGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-97s1c1
Sequence:CCGGGCCATTTATATGCTAACGCTTCTCGAGAAGCGTTAGCATATAAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-571s1c1
Sequence:CCGGGATACATACCTCACAGGAATACTCGAGTATTCCTGTGAGGTATGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-340s1c1
Sequence:CCGGCTGCTGATCATTGTGGCGTATCTCGAGATACGCCACAATGATCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-329s1c1
Sequence:CCGGCCGAGATCTTTCTGCTGATCACTCGAGTGATCAGCAGAAAGATCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-108s1c1
Sequence:CCGGGCTAACGCTTTCAGGGAACATCTCGAGATGTTCCCTGAAAGCGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-234s1c1
Sequence:CCGGGCCTAAGATGTTGGAGGGTTTCTCGAGAAACCCTCCAACATCTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001912
OR4E2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily E, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-587s1c1
Sequence:CCGGGAATACTGATTGTGACCAATACTCGAGTATTGGTCACAATCAGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-97s1c1
Sequence:CCGGGCCATTTATATGCTAACGCTTCTCGAGAAGCGTTAGCATATAAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-571s1c1
Sequence:CCGGGATACATACCTCACAGGAATACTCGAGTATTCCTGTGAGGTATGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-340s1c1
Sequence:CCGGCTGCTGATCATTGTGGCGTATCTCGAGATACGCCACAATGATCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-329s1c1
Sequence:CCGGCCGAGATCTTTCTGCTGATCACTCGAGTGATCAGCAGAAAGATCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-108s1c1
Sequence:CCGGGCTAACGCTTTCAGGGAACATCTCGAGATGTTCCCTGAAAGCGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-234s1c1
Sequence:CCGGGCCTAAGATGTTGGAGGGTTTCTCGAGAAACCCTCCAACATCTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001912
OR4E2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily E, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-587s1c1
Sequence:CCGGGAATACTGATTGTGACCAATACTCGAGTATTGGTCACAATCAGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-97s1c1
Sequence:CCGGGCCATTTATATGCTAACGCTTCTCGAGAAGCGTTAGCATATAAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-571s1c1
Sequence:CCGGGATACATACCTCACAGGAATACTCGAGTATTCCTGTGAGGTATGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-340s1c1
Sequence:CCGGCTGCTGATCATTGTGGCGTATCTCGAGATACGCCACAATGATCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-329s1c1
Sequence:CCGGCCGAGATCTTTCTGCTGATCACTCGAGTGATCAGCAGAAAGATCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-108s1c1
Sequence:CCGGGCTAACGCTTTCAGGGAACATCTCGAGATGTTCCCTGAAAGCGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001912.1-234s1c1
Sequence:CCGGGCCTAAGATGTTGGAGGGTTTCTCGAGAAACCCTCCAACATCTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)