EMAIL THIS PAGE TO A FRIEND

OR4F21

olfactory receptor, family 4, subfamily F, member 21

15 Gene Product Result for
Synonyms: OR4F21P
Species: Human OR4F21(441308)
UniProtKB ID: O95013, A6NIU1
Gene ID:
Human(441308) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005504 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005504 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206703 predicted 635
2 SASI_Hs01_00206704 predicted 468
3 SASI_Hs02_00304971 predicted 531
4 SASI_Hs01_00206705 predicted 417
5 SASI_Hs01_00206706 predicted 459
6 SASI_Hs01_00206707 predicted 623
7 SASI_Hs01_00206709 predicted 280
8 SASI_Hs01_00206711 predicted 306
9 SASI_Hs02_00304972 predicted 576
10 SASI_Hs02_00304973 predicted 244
11 SASI_Hs01_00206702 predicted 227
12 SASI_Hs01_00206708 predicted 706
13 SASI_Hs01_00206710 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005504
OR4F21 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily F, member 21
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-114s1c1
Sequence:CCGGCATTACTGGAAACATCTTCATCTCGAGATGAAGATGTTTCCAGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-222s1c1
Sequence:CCGGCTCTGTCACTTCTCCCAAGATCTCGAGATCTTGGGAGAAGTGACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-660s1c1
Sequence:CCGGCATCCTGTTTACTGTTTGGAACTCGAGTTCCAAACAGTAAACAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-265s1c1
Sequence:CCGGCGCAAAGTCATCTCCTTTGGACTCGAGTCCAAAGGAGATGACTTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-255s1c1
Sequence:CCGGGTTCAGAAAGCGCAAAGTCATCTCGAGATGACTTTGCGCTTTCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-597s1c1
Sequence:CCGGCACTGTTAACAGTGGGTTTATCTCGAGATAAACCCACTGTTAACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005504
OR4F21 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily F, member 21
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-114s1c1
Sequence:CCGGCATTACTGGAAACATCTTCATCTCGAGATGAAGATGTTTCCAGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-222s1c1
Sequence:CCGGCTCTGTCACTTCTCCCAAGATCTCGAGATCTTGGGAGAAGTGACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-660s1c1
Sequence:CCGGCATCCTGTTTACTGTTTGGAACTCGAGTTCCAAACAGTAAACAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-265s1c1
Sequence:CCGGCGCAAAGTCATCTCCTTTGGACTCGAGTCCAAAGGAGATGACTTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-255s1c1
Sequence:CCGGGTTCAGAAAGCGCAAAGTCATCTCGAGATGACTTTGCGCTTTCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-597s1c1
Sequence:CCGGCACTGTTAACAGTGGGTTTATCTCGAGATAAACCCACTGTTAACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005504
OR4F21 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily F, member 21
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-114s1c1
Sequence:CCGGCATTACTGGAAACATCTTCATCTCGAGATGAAGATGTTTCCAGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-222s1c1
Sequence:CCGGCTCTGTCACTTCTCCCAAGATCTCGAGATCTTGGGAGAAGTGACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-660s1c1
Sequence:CCGGCATCCTGTTTACTGTTTGGAACTCGAGTTCCAAACAGTAAACAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-265s1c1
Sequence:CCGGCGCAAAGTCATCTCCTTTGGACTCGAGTCCAAAGGAGATGACTTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-255s1c1
Sequence:CCGGGTTCAGAAAGCGCAAAGTCATCTCGAGATGACTTTGCGCTTTCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005504.1-597s1c1
Sequence:CCGGCACTGTTAACAGTGGGTTTATCTCGAGATAAACCCACTGTTAACAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)