EMAIL THIS PAGE TO A FRIEND

OR4F3

olfactory receptor, family 4, subfamily F, member 3

16 Gene Product Result for
Species: Human OR4F3(26683)
UniProtKB ID: Q6IEY1, B2RPQ6
Gene ID:
Human(26683) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005224 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005224 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128058 predicted 633
2 SASI_Hs01_00128059 predicted 469
3 SASI_Hs02_00304794 predicted 533
4 SASI_Hs01_00128060 predicted 417
5 SASI_Hs01_00128061 predicted 458
6 SASI_Hs01_00128062 predicted 616
7 SASI_Hs01_00128064 predicted 282
8 SASI_Hs01_00128066 predicted 579
9 SASI_Hs02_00304795 predicted 250
10 SASI_Hs02_00304796 predicted 455
11 SASI_Hs01_00128057 predicted 223
12 SASI_Hs01_00128063 predicted 703
13 SASI_Hs01_00128065 predicted 657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005224
OR4F3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily F, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-114s1c1
Sequence:CCGGCATTACTGGAAACATCCTCATCTCGAGATGAGGATGTTTCCAGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-237s1c1
Sequence:CCGGCAAGATGATTTATGACCTGTTCTCGAGAACAGGTCATAAATCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-633s1c1
Sequence:CCGGCTTCATACTTCTAATCTCCTACTCGAGTAGGAGATTAGAAGTATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-291s1c1
Sequence:CCGGCATCGCTCAAATCTTCTTCATCTCGAGATGAAGAAGATTTGAGCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-585s1c2
Sequence:CCGGGCAGTTCATGGTCACTGTTAACTCGAGTTAACAGTGACCATGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-349s1c1
Sequence:CCGGGCCATGGCCTTTGACAGATATCTCGAGATATCTGTCAAAGGCCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005224
OR4F3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily F, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-114s1c1
Sequence:CCGGCATTACTGGAAACATCCTCATCTCGAGATGAGGATGTTTCCAGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-237s1c1
Sequence:CCGGCAAGATGATTTATGACCTGTTCTCGAGAACAGGTCATAAATCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-633s1c1
Sequence:CCGGCTTCATACTTCTAATCTCCTACTCGAGTAGGAGATTAGAAGTATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-291s1c1
Sequence:CCGGCATCGCTCAAATCTTCTTCATCTCGAGATGAAGAAGATTTGAGCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-585s1c2
Sequence:CCGGGCAGTTCATGGTCACTGTTAACTCGAGTTAACAGTGACCATGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-349s1c1
Sequence:CCGGGCCATGGCCTTTGACAGATATCTCGAGATATCTGTCAAAGGCCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005224
OR4F3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily F, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-114s1c1
Sequence:CCGGCATTACTGGAAACATCCTCATCTCGAGATGAGGATGTTTCCAGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-237s1c1
Sequence:CCGGCAAGATGATTTATGACCTGTTCTCGAGAACAGGTCATAAATCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-633s1c1
Sequence:CCGGCTTCATACTTCTAATCTCCTACTCGAGTAGGAGATTAGAAGTATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-291s1c1
Sequence:CCGGCATCGCTCAAATCTTCTTCATCTCGAGATGAAGAAGATTTGAGCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-585s1c2
Sequence:CCGGGCAGTTCATGGTCACTGTTAACTCGAGTTAACAGTGACCATGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005224.1-349s1c1
Sequence:CCGGGCCATGGCCTTTGACAGATATCTCGAGATATCTGTCAAAGGCCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)