EMAIL THIS PAGE TO A FRIEND

OR4F5

olfactory receptor, family 4, subfamily F, member 5

15 Gene Product Result for
Species: Human OR4F5(79501)
UniProtKB ID: Q8NH21, Q5VT22
Gene ID:
Human(79501) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302327 ANTI-OR4F5 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005484 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005484 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239893 predicted 541
2 SASI_Hs01_00239894 predicted 457
3 SASI_Hs01_00239895 predicted 653
4 SASI_Hs01_00239897 predicted 606
5 SASI_Hs01_00239898 predicted 643
6 SASI_Hs01_00239899 predicted 235
7 SASI_Hs01_00239900 predicted 658
8 SASI_Hs01_00239901 predicted 331
9 SASI_Hs02_00304946 predicted 516
10 SASI_Hs02_00304947 predicted 632
11 SASI_Hs01_00239892 predicted 260
12 SASI_Hs01_00239896 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005484
OR4F5 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily F, member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-335s1c1
Sequence:CCGGGCTTTGACAGATATATAGCAACTCGAGTTGCTATATATCTGTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-548s1c1
Sequence:CCGGCAGATACCTACAGGCTAGATACTCGAGTATCTAGCCTGTAGGTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-664s1c1
Sequence:CCGGCCTTTAGATAAGTCGTCCAAACTCGAGTTTGGACGACTTATCTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-51s1c1
Sequence:CCGGGACCTTCCTATTTATGTTGTTCTCGAGAACAACATAAATAGGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-306s1c1
Sequence:CCGGGAGTGAGATGGTGATCCTCATCTCGAGATGAGGATCACCATCTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-105s1c1
Sequence:CCGGCCTTCTTATTGTCATAACAGTCTCGAGACTGTTATGACAATAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-270s1c1
Sequence:CCGGCCTTGTTCAGATATTTCTCCTCTCGAGAGGAGAAATATCTGAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005484
OR4F5 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily F, member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-335s1c1
Sequence:CCGGGCTTTGACAGATATATAGCAACTCGAGTTGCTATATATCTGTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-548s1c1
Sequence:CCGGCAGATACCTACAGGCTAGATACTCGAGTATCTAGCCTGTAGGTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-664s1c1
Sequence:CCGGCCTTTAGATAAGTCGTCCAAACTCGAGTTTGGACGACTTATCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-51s1c1
Sequence:CCGGGACCTTCCTATTTATGTTGTTCTCGAGAACAACATAAATAGGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-306s1c1
Sequence:CCGGGAGTGAGATGGTGATCCTCATCTCGAGATGAGGATCACCATCTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-105s1c1
Sequence:CCGGCCTTCTTATTGTCATAACAGTCTCGAGACTGTTATGACAATAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-270s1c1
Sequence:CCGGCCTTGTTCAGATATTTCTCCTCTCGAGAGGAGAAATATCTGAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005484
OR4F5 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily F, member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-335s1c1
Sequence:CCGGGCTTTGACAGATATATAGCAACTCGAGTTGCTATATATCTGTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-548s1c1
Sequence:CCGGCAGATACCTACAGGCTAGATACTCGAGTATCTAGCCTGTAGGTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-664s1c1
Sequence:CCGGCCTTTAGATAAGTCGTCCAAACTCGAGTTTGGACGACTTATCTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-51s1c1
Sequence:CCGGGACCTTCCTATTTATGTTGTTCTCGAGAACAACATAAATAGGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-306s1c1
Sequence:CCGGGAGTGAGATGGTGATCCTCATCTCGAGATGAGGATCACCATCTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-105s1c1
Sequence:CCGGCCTTCTTATTGTCATAACAGTCTCGAGACTGTTATGACAATAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005484.1-270s1c1
Sequence:CCGGCCTTGTTCAGATATTTCTCCTCTCGAGAGGAGAAATATCTGAACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)