EMAIL THIS PAGE TO A FRIEND

OR4F6

olfactory receptor, family 4, subfamily F, member 6

17 Gene Product Result for
Synonyms: OR15-15 OR4F12
Species: Human OR4F6(390648)
UniProtKB ID: Q8NGB9, B9EH28, Q6IF95
Gene ID:
Human(390648) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303934 ANTI-OR4F6 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4501714 Anti-OR4F6 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372596 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138551 MISSION® esiRNA esiRNA human OR4F6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005326 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192085 predicted 510
2 SASI_Hs01_00192086 predicted 594
3 SASI_Hs01_00192087 predicted 459
4 SASI_Hs01_00192088 predicted 573
5 SASI_Hs01_00192090 predicted 699
6 SASI_Hs01_00192091 predicted 434
7 SASI_Hs01_00192092 predicted 534
8 SASI_Hs01_00192093 predicted 529
9 SASI_Hs02_00304841 predicted 538
10 SASI_Hs02_00304842 predicted 634
11 SASI_Hs01_00192084 predicted 715
12 SASI_Hs01_00192089 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372596
OR4F6 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily F, member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-724s1c1
Sequence:CCGGGCTCATGTCATTGTGGTGGTTCTCGAGAACCACCACAATGACATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-192s1c1
Sequence:CCGGCAACCTTTCCATCATCAATTTCTCGAGAAATTGATGATGGAAAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-545s1c1
Sequence:CCGGCTCGATTTATCAAACTGGCTTCTCGAGAAGCCAGTTTGATAAATCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-190s1c1
Sequence:CCGGGCCAACCTTTCCATCATCAATCTCGAGATTGATGATGGAAAGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-788s1c1
Sequence:CCGGCCACATCACATCTTGATAAATCTCGAGATTTATCAAGATGTGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-611s1c1
Sequence:CCGGGATTTATTTCTCTGGCTTCTTCTCGAGAAGAAGCCAGAGAAATAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-114s1c1
Sequence:CCGGCCTGATGGGAAATCTCCTCATCTCGAGATGAGGAGATTTCCCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-236s1c1
Sequence:CCGGCCAAGATGATTTATGACCTTTCTCGAGAAAGGTCATAAATCATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372596
OR4F6 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily F, member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-724s1c1
Sequence:CCGGGCTCATGTCATTGTGGTGGTTCTCGAGAACCACCACAATGACATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-192s1c1
Sequence:CCGGCAACCTTTCCATCATCAATTTCTCGAGAAATTGATGATGGAAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-545s1c1
Sequence:CCGGCTCGATTTATCAAACTGGCTTCTCGAGAAGCCAGTTTGATAAATCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-190s1c1
Sequence:CCGGGCCAACCTTTCCATCATCAATCTCGAGATTGATGATGGAAAGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-788s1c1
Sequence:CCGGCCACATCACATCTTGATAAATCTCGAGATTTATCAAGATGTGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-611s1c1
Sequence:CCGGGATTTATTTCTCTGGCTTCTTCTCGAGAAGAAGCCAGAGAAATAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-114s1c1
Sequence:CCGGCCTGATGGGAAATCTCCTCATCTCGAGATGAGGAGATTTCCCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-236s1c1
Sequence:CCGGCCAAGATGATTTATGACCTTTCTCGAGAAAGGTCATAAATCATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372596
OR4F6 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily F, member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-724s1c1
Sequence:CCGGGCTCATGTCATTGTGGTGGTTCTCGAGAACCACCACAATGACATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-192s1c1
Sequence:CCGGCAACCTTTCCATCATCAATTTCTCGAGAAATTGATGATGGAAAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-545s1c1
Sequence:CCGGCTCGATTTATCAAACTGGCTTCTCGAGAAGCCAGTTTGATAAATCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-190s1c1
Sequence:CCGGGCCAACCTTTCCATCATCAATCTCGAGATTGATGATGGAAAGGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-788s1c1
Sequence:CCGGCCACATCACATCTTGATAAATCTCGAGATTTATCAAGATGTGATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-611s1c1
Sequence:CCGGGATTTATTTCTCTGGCTTCTTCTCGAGAAGAAGCCAGAGAAATAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-114s1c1
Sequence:CCGGCCTGATGGGAAATCTCCTCATCTCGAGATGAGGAGATTTCCCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372596.1-236s1c1
Sequence:CCGGCCAAGATGATTTATGACCTTTCTCGAGAAAGGTCATAAATCATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)