EMAIL THIS PAGE TO A FRIEND

OR4K5

olfactory receptor, family 4, subfamily K, member 5

15 Gene Product Result for
Synonyms: OR14-16
UniProtKB ID: Q8NGD3, Q6IFA7
Gene ID:
Human(79317) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(516054) olfactory receptor, family 4, subfamily K, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302330 ANTI-OR4K5 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005483 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150961 MISSION® esiRNA esiRNA human OR4K5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005483 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016047 predicted 399
2 SASI_Hs01_00016048 predicted 469
3 SASI_Hs01_00016049 predicted 463
4 SASI_Hs01_00016050 predicted 724
5 SASI_Hs01_00016051 predicted 459
6 SASI_Hs01_00016052 predicted 258
7 SASI_Hs02_00304945 predicted 581
8 SASI_Hs01_00016053 predicted 459
9 SASI_Hs01_00016054 predicted 378
10 SASI_Hs01_00016055 predicted 714
11 SASI_Hs01_00016056 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005483
OR4K5 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily K, member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-109s1c1
Sequence:CCGGGTCATTGTGCTGGGAAATCTTCTCGAGAAGATTTCCCAGCACAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-691s1c1
Sequence:CCGGGCTGCAATGGCAAAGGCATTTCTCGAGAAATGCCTTTGCCATTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-375s1c1
Sequence:CCGGCATATGCAAACCCTTATACTACTCGAGTAGTATAAGGGTTTGCATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-339s1c1
Sequence:CCGGGCTACTTGTTTCGATGGCCTACTCGAGTAGGCCATCGAAACAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-721s1c1
Sequence:CCGGGCTTCCCATATTGCAGTAGTACTCGAGTACTACTGCAATATGGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-460s1c1
Sequence:CCGGGTGCACACATTAAGCCAGTTACTCGAGTAACTGGCTTAATGTGTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-474s1c1
Sequence:CCGGCCAGTTATCATTTACTGTGAACTCGAGTTCACAGTAAATGATAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005483
OR4K5 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily K, member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-109s1c1
Sequence:CCGGGTCATTGTGCTGGGAAATCTTCTCGAGAAGATTTCCCAGCACAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-691s1c1
Sequence:CCGGGCTGCAATGGCAAAGGCATTTCTCGAGAAATGCCTTTGCCATTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-375s1c1
Sequence:CCGGCATATGCAAACCCTTATACTACTCGAGTAGTATAAGGGTTTGCATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-339s1c1
Sequence:CCGGGCTACTTGTTTCGATGGCCTACTCGAGTAGGCCATCGAAACAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-721s1c1
Sequence:CCGGGCTTCCCATATTGCAGTAGTACTCGAGTACTACTGCAATATGGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-460s1c1
Sequence:CCGGGTGCACACATTAAGCCAGTTACTCGAGTAACTGGCTTAATGTGTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-474s1c1
Sequence:CCGGCCAGTTATCATTTACTGTGAACTCGAGTTCACAGTAAATGATAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005483
OR4K5 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily K, member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-109s1c1
Sequence:CCGGGTCATTGTGCTGGGAAATCTTCTCGAGAAGATTTCCCAGCACAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-691s1c1
Sequence:CCGGGCTGCAATGGCAAAGGCATTTCTCGAGAAATGCCTTTGCCATTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-375s1c1
Sequence:CCGGCATATGCAAACCCTTATACTACTCGAGTAGTATAAGGGTTTGCATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-339s1c1
Sequence:CCGGGCTACTTGTTTCGATGGCCTACTCGAGTAGGCCATCGAAACAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-721s1c1
Sequence:CCGGGCTTCCCATATTGCAGTAGTACTCGAGTACTACTGCAATATGGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-460s1c1
Sequence:CCGGGTGCACACATTAAGCCAGTTACTCGAGTAACTGGCTTAATGTGTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005483.1-474s1c1
Sequence:CCGGCCAGTTATCATTTACTGTGAACTCGAGTTCACAGTAAATGATAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)