EMAIL THIS PAGE TO A FRIEND

OR4L1

olfactory receptor, family 4, subfamily L, member 1

16 Gene Product Result for
Synonyms: OR14-28 OR4L2P
UniProtKB ID: Q8NH43, Q6IEZ5
Gene ID:
Human(122742) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(512103) olfactory receptor, family 4, subfamily L, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304238 ANTI-OR4L1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4500323 Anti-OR4L1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_063310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_063310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_063310 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138401 MISSION® esiRNA esiRNA human OR4L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004717 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154934 predicted 606
2 SASI_Hs01_00154935 predicted 326
3 SASI_Hs01_00154936 predicted 580
4 SASI_Hs01_00154938 predicted 554
5 SASI_Hs01_00154939 predicted 694
6 SASI_Hs01_00154940 predicted 461
7 SASI_Hs01_00154941 predicted 383
8 SASI_Hs01_00154942 predicted 317
9 SASI_Hs01_00154943 predicted 549
10 SASI_Hs02_00304672 predicted 502
11 SASI_Hs01_00154937 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_063310
OR4L1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily L, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-297s1c1
Sequence:CCGGCCAGATGTTCTTCATGCACTTCTCGAGAAGTGCATGAAGAACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-642s1c1
Sequence:CCGGGCTTGTTTCTTACATTGTCATCTCGAGATGACAATGTAAGAAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-109s1c1
Sequence:CCGGGCTACTGTGATGGGAAACATTCTCGAGAATGTTTCCCATCACAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-433s1c1
Sequence:CCGGGCGATACTTTCATGGATAATTCTCGAGAATTATCCATGAAAGTATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_063310
OR4L1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily L, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-297s1c1
Sequence:CCGGCCAGATGTTCTTCATGCACTTCTCGAGAAGTGCATGAAGAACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-642s1c1
Sequence:CCGGGCTTGTTTCTTACATTGTCATCTCGAGATGACAATGTAAGAAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-109s1c1
Sequence:CCGGGCTACTGTGATGGGAAACATTCTCGAGAATGTTTCCCATCACAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-433s1c1
Sequence:CCGGGCGATACTTTCATGGATAATTCTCGAGAATTATCCATGAAAGTATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_063310
OR4L1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily L, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-297s1c1
Sequence:CCGGCCAGATGTTCTTCATGCACTTCTCGAGAAGTGCATGAAGAACATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-642s1c1
Sequence:CCGGGCTTGTTTCTTACATTGTCATCTCGAGATGACAATGTAAGAAACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-109s1c1
Sequence:CCGGGCTACTGTGATGGGAAACATTCTCGAGAATGTTTCCCATCACAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_063310.1-433s1c1
Sequence:CCGGGCGATACTTTCATGGATAATTCTCGAGAATTATCCATGAAAGTATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)