EMAIL THIS PAGE TO A FRIEND

OR4N2

olfactory receptor, family 4, subfamily N, member 2

16 Gene Product Result for
Synonyms: OR14-13 OR14-8
UniProtKB ID: Q8NGD1, Q6IEY9, Q6IFA2
Gene ID:
Human(390429) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(482536) cOR4N6 olfactory receptor family 4 subfamily N-like
cow(515867) olfactory receptor, family 4, subfamily N, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301890 ANTI-OR4N2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372500 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159791 MISSION® esiRNA esiRNA human OR4N2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004723 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069804 predicted 259
2 SASI_Hs01_00069806 predicted 389
3 SASI_Hs01_00069807 predicted 248
4 SASI_Hs01_00069808 predicted 251
5 SASI_Hs01_00069809 predicted 382
6 SASI_Hs01_00069810 predicted 701
7 SASI_Hs02_00304679 predicted 846
8 SASI_Hs02_00304680 predicted 9
9 SASI_Hs01_00069805 predicted 570
10 SASI_Hs01_00069811 predicted 660
11 SASI_Hs01_00069812 predicted 667
12 SASI_Hs01_00069813 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372500
OR4N2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily N, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-655s1c2
Sequence:CCGGGCAGTCATTCTTTGTCGCATACTCGAGTATGCGACAAAGAATGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-174s1c1
Sequence:CCGGCCTCTATTTCTTTCTGGGCAACTCGAGTTGCCCAGAAAGAAATAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-411s1c1
Sequence:CCGGCCCTAGAACCTGCTATGCAATCTCGAGATTGCATAGCAGGTTCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-571s1c1
Sequence:CCGGGACACATTTGTGGTGGAGCTTCTCGAGAAGCTCCACCACAAATGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372500
OR4N2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily N, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-655s1c2
Sequence:CCGGGCAGTCATTCTTTGTCGCATACTCGAGTATGCGACAAAGAATGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-174s1c1
Sequence:CCGGCCTCTATTTCTTTCTGGGCAACTCGAGTTGCCCAGAAAGAAATAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-411s1c1
Sequence:CCGGCCCTAGAACCTGCTATGCAATCTCGAGATTGCATAGCAGGTTCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-571s1c1
Sequence:CCGGGACACATTTGTGGTGGAGCTTCTCGAGAAGCTCCACCACAAATGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372500
OR4N2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily N, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-655s1c2
Sequence:CCGGGCAGTCATTCTTTGTCGCATACTCGAGTATGCGACAAAGAATGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-174s1c1
Sequence:CCGGCCTCTATTTCTTTCTGGGCAACTCGAGTTGCCCAGAAAGAAATAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-411s1c1
Sequence:CCGGCCCTAGAACCTGCTATGCAATCTCGAGATTGCATAGCAGGTTCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372500.1-571s1c1
Sequence:CCGGGACACATTTGTGGTGGAGCTTCTCGAGAAGCTCCACCACAAATGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)