EMAIL THIS PAGE TO A FRIEND

OR4N4

olfactory receptor, family 4, subfamily N, member 4

18 Gene Product Result for
Synonyms: OR15-1 OR15-5
UniProtKB ID: Q8N0Y3, Q6IEY3, Q6IF56
Gene ID:
Human(283694) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(510676) olfactory receptor, family 4, subfamily N, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005241 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111721 MISSION® esiRNA esiRNA human OR4N4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005241 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120622 predicted 701
2 SASI_Hs01_00120623 predicted 711
3 SASI_Hs01_00120628 predicted 385
4 SASI_Hs01_00120624 predicted 719
5 SASI_Hs01_00120626 predicted 659
6 SASI_Hs01_00120625 predicted 677
7 SASI_Hs01_00120629 predicted 725
8 SASI_Hs01_00120630 predicted 728
9 SASI_Hs01_00120631 predicted 890
10 SASI_Hs02_00304806 predicted 77
11 SASI_Hs01_00120627 predicted 571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005241
OR4N4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily N, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-390s1c1
Sequence:CCGGGCACTGTTCAACTGTCATGAACTCGAGTTCATGACAGTTGAACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-719s1c1
Sequence:CCGGGCACCACTCGTGTCATTATTACTCGAGTAATAATGACACGAGTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-255s1c1
Sequence:CCGGCTTCTCTGAGAAGAAGGTAATCTCGAGATTACCTTCTTCTCAGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-79s1c1
Sequence:CCGGGTCTTTGTGCTGATCTTAATTCTCGAGAATTAAGATCAGCACAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-57s1c1
Sequence:CCGGGTCTCAAGATATTCAGCTCTTCTCGAGAAGAGCTGAATATCTTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-208s1c1
Sequence:CCGGGATGCATCCTACTCCTTCATTCTCGAGAATGAAGGAGTAGGATGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-72s1c1
Sequence:CCGGGCTCTTGGTCTTTGTGCTGATCTCGAGATCAGCACAAAGACCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-613s1c1
Sequence:CCGGCTGATGACACTCCTGTGCTTTCTCGAGAAAGCACAGGAGTGTCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005241
OR4N4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily N, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-390s1c1
Sequence:CCGGGCACTGTTCAACTGTCATGAACTCGAGTTCATGACAGTTGAACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-719s1c1
Sequence:CCGGGCACCACTCGTGTCATTATTACTCGAGTAATAATGACACGAGTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-255s1c1
Sequence:CCGGCTTCTCTGAGAAGAAGGTAATCTCGAGATTACCTTCTTCTCAGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-79s1c1
Sequence:CCGGGTCTTTGTGCTGATCTTAATTCTCGAGAATTAAGATCAGCACAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-57s1c1
Sequence:CCGGGTCTCAAGATATTCAGCTCTTCTCGAGAAGAGCTGAATATCTTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-208s1c1
Sequence:CCGGGATGCATCCTACTCCTTCATTCTCGAGAATGAAGGAGTAGGATGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-72s1c1
Sequence:CCGGGCTCTTGGTCTTTGTGCTGATCTCGAGATCAGCACAAAGACCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-613s1c1
Sequence:CCGGCTGATGACACTCCTGTGCTTTCTCGAGAAAGCACAGGAGTGTCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005241
OR4N4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily N, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-390s1c1
Sequence:CCGGGCACTGTTCAACTGTCATGAACTCGAGTTCATGACAGTTGAACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-719s1c1
Sequence:CCGGGCACCACTCGTGTCATTATTACTCGAGTAATAATGACACGAGTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-255s1c1
Sequence:CCGGCTTCTCTGAGAAGAAGGTAATCTCGAGATTACCTTCTTCTCAGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-79s1c1
Sequence:CCGGGTCTTTGTGCTGATCTTAATTCTCGAGAATTAAGATCAGCACAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-57s1c1
Sequence:CCGGGTCTCAAGATATTCAGCTCTTCTCGAGAAGAGCTGAATATCTTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-208s1c1
Sequence:CCGGGATGCATCCTACTCCTTCATTCTCGAGAATGAAGGAGTAGGATGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-72s1c1
Sequence:CCGGGCTCTTGGTCTTTGTGCTGATCTCGAGATCAGCACAAAGACCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005241.1-613s1c1
Sequence:CCGGCTGATGACACTCCTGTGCTTTCTCGAGAAAGCACAGGAGTGTCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)