EMAIL THIS PAGE TO A FRIEND

OR4S1

olfactory receptor, family 4, subfamily S, member 1

16 Gene Product Result for
Synonyms: OR11-100
UniProtKB ID: Q8NGB4, Q6IFB4
Gene ID:
Human(256148) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(510451) olfactory receptor, family 4, subfamily S, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305943 ANTI-OR4S1 (C-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_171490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_171490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_171490 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004725 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197456 predicted 390
2 SASI_Hs01_00197457 predicted 501
3 SASI_Hs01_00197459 predicted 230
4 SASI_Hs02_00304681 predicted 443
5 SASI_Hs02_00304682 predicted 707
6 SASI_Hs01_00197460 predicted 638
7 SASI_Hs01_00197461 predicted 595
8 SASI_Hs01_00197462 predicted 686
9 SASI_Hs02_00304683 predicted 211
10 SASI_Hs01_00197464 predicted 257
11 SASI_Hs01_00197458 predicted 590
12 SASI_Hs01_00197463 predicted 212
13 SASI_Hs01_00197465 predicted 197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_171490
OR4S1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily S, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-155s1c1
Sequence:CCGGCCCTGAAGTCTCCCATGTATTCTCGAGAATACATGGGAGACTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-649s1c1
Sequence:CCGGGTTATCATCTTACTGAACCTACTCGAGTAGGTTCAGTAAGATGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-504s1c1
Sequence:CCGGGCCCAATGAGATAGACAACTTCTCGAGAAGTTGTCTATCTCATTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-258s1c1
Sequence:CCGGGCATAAGATCATCTCCTTCAACTCGAGTTGAAGGAGATGATCTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-156s1c1
Sequence:CCGGCCTGAAGTCTCCCATGTATTTCTCGAGAAATACATGGGAGACTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-64s1c1
Sequence:CCGGCAGCATACATGCTTTGTGGTACTCGAGTACCACAAAGCATGTATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_171490
OR4S1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily S, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-155s1c1
Sequence:CCGGCCCTGAAGTCTCCCATGTATTCTCGAGAATACATGGGAGACTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-649s1c1
Sequence:CCGGGTTATCATCTTACTGAACCTACTCGAGTAGGTTCAGTAAGATGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-504s1c1
Sequence:CCGGGCCCAATGAGATAGACAACTTCTCGAGAAGTTGTCTATCTCATTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-258s1c1
Sequence:CCGGGCATAAGATCATCTCCTTCAACTCGAGTTGAAGGAGATGATCTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-156s1c1
Sequence:CCGGCCTGAAGTCTCCCATGTATTTCTCGAGAAATACATGGGAGACTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-64s1c1
Sequence:CCGGCAGCATACATGCTTTGTGGTACTCGAGTACCACAAAGCATGTATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_171490
OR4S1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily S, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-155s1c1
Sequence:CCGGCCCTGAAGTCTCCCATGTATTCTCGAGAATACATGGGAGACTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-649s1c1
Sequence:CCGGGTTATCATCTTACTGAACCTACTCGAGTAGGTTCAGTAAGATGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-504s1c1
Sequence:CCGGGCCCAATGAGATAGACAACTTCTCGAGAAGTTGTCTATCTCATTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-258s1c1
Sequence:CCGGGCATAAGATCATCTCCTTCAACTCGAGTTGAAGGAGATGATCTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-156s1c1
Sequence:CCGGCCTGAAGTCTCCCATGTATTTCTCGAGAAATACATGGGAGACTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_171490.3-64s1c1
Sequence:CCGGCAGCATACATGCTTTGTGGTACTCGAGTACCACAAAGCATGTATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)