EMAIL THIS PAGE TO A FRIEND

OR4S2

olfactory receptor, family 4, subfamily S, member 2

16 Gene Product Result for
Synonyms: OR11-137 OR4S2P OST725
UniProtKB ID: Q8NH73, Q6IF72
Gene ID:
Human(219431) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483616) cOR4S3 olfactory receptor family 4 subfamily S-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302091 ANTI-OR4S2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166871 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004059 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304454 predicted 289
2 SASI_Hs01_00036778 predicted 524
3 SASI_Hs01_00036777 predicted 299
4 SASI_Hs01_00036779 predicted 564
5 SASI_Hs01_00036780 predicted 637
6 SASI_Hs01_00036781 predicted 240
7 SASI_Hs01_00036782 predicted 494
8 SASI_Hs01_00036784 predicted 227
9 SASI_Hs02_00304455 predicted 275
10 SASI_Hs02_00304456 predicted 279
11 SASI_Hs01_00036776 predicted 441
12 SASI_Hs01_00036783 predicted 294
13 SASI_Hs01_00036785 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166871
OR4S2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily S, member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-1102s1c1
Sequence:CCGGGCCTGCACAGAAACATACATTCTCGAGAATGTATGTTTCTGTGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-61s1c1
Sequence:CCGGCCCAAATTAATGGTTGACTTACTCGAGTAAGTCAACCATTAATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-873s1c1
Sequence:CCGGGATCTTCATCCTTACTGTAATCTCGAGATTACAGTAAGGATGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-213s1c1
Sequence:CCGGCCTGCACTACACCATTATTATCTCGAGATAATAATGGTGTAGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-527s1c1
Sequence:CCGGGCAAAGCTCTTGCCACTTGTACTCGAGTACAAGTGGCAAGAGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-583s1c1
Sequence:CCGGCCTGCATTGTTCATTTACATTCTCGAGAATGTAAATGAACAATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166871
OR4S2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily S, member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-1102s1c1
Sequence:CCGGGCCTGCACAGAAACATACATTCTCGAGAATGTATGTTTCTGTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-61s1c1
Sequence:CCGGCCCAAATTAATGGTTGACTTACTCGAGTAAGTCAACCATTAATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-873s1c1
Sequence:CCGGGATCTTCATCCTTACTGTAATCTCGAGATTACAGTAAGGATGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-213s1c1
Sequence:CCGGCCTGCACTACACCATTATTATCTCGAGATAATAATGGTGTAGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-527s1c1
Sequence:CCGGGCAAAGCTCTTGCCACTTGTACTCGAGTACAAGTGGCAAGAGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-583s1c1
Sequence:CCGGCCTGCATTGTTCATTTACATTCTCGAGAATGTAAATGAACAATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166871
OR4S2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily S, member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-1102s1c1
Sequence:CCGGGCCTGCACAGAAACATACATTCTCGAGAATGTATGTTTCTGTGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-61s1c1
Sequence:CCGGCCCAAATTAATGGTTGACTTACTCGAGTAAGTCAACCATTAATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-873s1c1
Sequence:CCGGGATCTTCATCCTTACTGTAATCTCGAGATTACAGTAAGGATGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-213s1c1
Sequence:CCGGCCTGCACTACACCATTATTATCTCGAGATAATAATGGTGTAGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-527s1c1
Sequence:CCGGGCAAAGCTCTTGCCACTTGTACTCGAGTACAAGTGGCAAGAGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166871.3-583s1c1
Sequence:CCGGCCTGCATTGTTCATTTACATTCTCGAGAATGTAAATGAACAATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)