EMAIL THIS PAGE TO A FRIEND

OR4X1

olfactory receptor, family 4, subfamily X, member 1

16 Gene Product Result for
Synonyms: OR11-104
UniProtKB ID: Q8NH49, Q6IF74
Gene ID:
Human(390113) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(510452) olfactory receptor, family 4, subfamily X, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501690 Anti-OR4X1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB1305205 ANTI-OR4X1(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004726 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036646 predicted 398
2 SASI_Hs02_00304684 predicted 242
3 SASI_Hs01_00036648 predicted 393
4 SASI_Hs02_00304685 predicted 600
5 SASI_Hs01_00036650 predicted 601
6 SASI_Hs01_00036651 predicted 652
7 SASI_Hs01_00036652 predicted 557
8 SASI_Hs01_00036653 predicted 415
9 SASI_Hs01_00036654 predicted 632
10 SASI_Hs01_00036655 predicted 519
11 SASI_Hs01_00036647 predicted 327
12 SASI_Hs01_00036649 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372376
OR4X1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 4, subfamily X, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-63s1c1
Sequence:CCGGGCAGAGGGTCATTTCTGTGATCTCGAGATCACAGAAATGACCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-234s1c1
Sequence:CCGGGCTTATCTTTGACTCCTTTATCTCGAGATAAAGGAGTCAAAGATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-171s1c1
Sequence:CCGGGTATTTCTTTCTCAGCTACTTCTCGAGAAGTAGCTGAGAAAGAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-168s1c1
Sequence:CCGGCATGTATTTCTTTCTCAGCTACTCGAGTAGCTGAGAAAGAAATACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-66s1c1
Sequence:CCGGGAGGGTCATTTCTGTGATGTTCTCGAGAACATCACAGAAATGACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372376
OR4X1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 4, subfamily X, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-63s1c1
Sequence:CCGGGCAGAGGGTCATTTCTGTGATCTCGAGATCACAGAAATGACCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-234s1c1
Sequence:CCGGGCTTATCTTTGACTCCTTTATCTCGAGATAAAGGAGTCAAAGATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-171s1c1
Sequence:CCGGGTATTTCTTTCTCAGCTACTTCTCGAGAAGTAGCTGAGAAAGAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-168s1c1
Sequence:CCGGCATGTATTTCTTTCTCAGCTACTCGAGTAGCTGAGAAAGAAATACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-66s1c1
Sequence:CCGGGAGGGTCATTTCTGTGATGTTCTCGAGAACATCACAGAAATGACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372376
OR4X1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 4, subfamily X, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-63s1c1
Sequence:CCGGGCAGAGGGTCATTTCTGTGATCTCGAGATCACAGAAATGACCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-234s1c1
Sequence:CCGGGCTTATCTTTGACTCCTTTATCTCGAGATAAAGGAGTCAAAGATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-171s1c1
Sequence:CCGGGTATTTCTTTCTCAGCTACTTCTCGAGAAGTAGCTGAGAAAGAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-168s1c1
Sequence:CCGGCATGTATTTCTTTCTCAGCTACTCGAGTAGCTGAGAAAGAAATACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372376.1-66s1c1
Sequence:CCGGGAGGGTCATTTCTGTGATGTTCTCGAGAACATCACAGAAATGACCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)