EMAIL THIS PAGE TO A FRIEND

OR51A4

olfactory receptor, family 51, subfamily A, member 4

13 Gene Product Result for
Species: Human OR51A4(401666)
UniProtKB ID: Q8NGJ6
Gene ID:
Human(401666) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501773 Anti-OR51A4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_377158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377158 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005329 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045014 predicted 647
2 SASI_Hs01_00045015 predicted 665
3 SASI_Hs01_00045016 predicted 205
4 SASI_Hs01_00045017 predicted 398
5 SASI_Hs01_00045018 predicted 422
6 SASI_Hs01_00045019 predicted 616
7 SASI_Hs01_00045020 predicted 699
8 SASI_Hs01_00045021 predicted 201
9 SASI_Hs01_00045022 predicted 520
10 SASI_Hs01_00045023 predicted 434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377158
OR51A4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily A, member 4
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000194276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377158.1-261s1c2
Sequence:CCGGCCTGTTCAATGCTCCTGAAATCTCGAGATTTCAGGAGCATTGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377158
OR51A4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily A, member 4
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000194276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377158.1-261s1c2
Sequence:CCGGCCTGTTCAATGCTCCTGAAATCTCGAGATTTCAGGAGCATTGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377158
OR51A4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily A, member 4
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000194276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377158.1-261s1c2
Sequence:CCGGCCTGTTCAATGCTCCTGAAATCTCGAGATTTCAGGAGCATTGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)