EMAIL THIS PAGE TO A FRIEND

OR51A7

olfactory receptor, family 51, subfamily A, member 7

18 Gene Product Result for
Synonyms: OR11-27
UniProtKB ID: Q8NH64, Q6IFH8
Gene ID:
Human(119687) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(784346) olfactory receptor, family 51, subfamily A, member 7
Domestic Rabbit(100328832) olfactory receptor, family 51, subfamily A, member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_061619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_061619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_061619 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137291 MISSION® esiRNA esiRNA human OR51A7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004749 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078422 predicted 637
2 SASI_Hs01_00078423 predicted 580
3 SASI_Hs01_00078424 predicted 437
4 SASI_Hs01_00078425 predicted 405
5 SASI_Hs01_00078426 predicted 275
6 SASI_Hs01_00078427 predicted 318
7 SASI_Hs01_00078428 predicted 233
8 SASI_Hs01_00078430 predicted 521
9 SASI_Hs02_00304698 predicted 564
10 SASI_Hs02_00304699 predicted 380
11 SASI_Hs01_00078429 predicted 295
12 SASI_Hs01_00078431 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_061619
OR51A7 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily A, member 7
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000189418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-363s1c1
Sequence:CCGGCCGCTTTCTTGCCATTCACAACTCGAGTTGTGAATGGCAAGAAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-364s1c1
Sequence:CCGGCGCTTTCTTGCCATTCACAATCTCGAGATTGTGAATGGCAAGAAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-596s1c1
Sequence:CCGGGCTTCTTCATTGCTCTCTGTACTCGAGTACAGAGAGCAATGAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-455s1c1
Sequence:CCGGGCATTCTCTTAGTGATTCCATCTCGAGATGGAATCACTAAGAGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_061619
OR51A7 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily A, member 7
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000189418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-363s1c1
Sequence:CCGGCCGCTTTCTTGCCATTCACAACTCGAGTTGTGAATGGCAAGAAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-364s1c1
Sequence:CCGGCGCTTTCTTGCCATTCACAATCTCGAGATTGTGAATGGCAAGAAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-596s1c1
Sequence:CCGGGCTTCTTCATTGCTCTCTGTACTCGAGTACAGAGAGCAATGAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-455s1c1
Sequence:CCGGGCATTCTCTTAGTGATTCCATCTCGAGATGGAATCACTAAGAGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_061619
OR51A7 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily A, member 7
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000189418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-363s1c1
Sequence:CCGGCCGCTTTCTTGCCATTCACAACTCGAGTTGTGAATGGCAAGAAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-364s1c1
Sequence:CCGGCGCTTTCTTGCCATTCACAATCTCGAGATTGTGAATGGCAAGAAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-596s1c1
Sequence:CCGGGCTTCTTCATTGCTCTCTGTACTCGAGTACAGAGAGCAATGAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061619.2-455s1c1
Sequence:CCGGGCATTCTCTTAGTGATTCCATCTCGAGATGGAATCACTAAGAGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)