EMAIL THIS PAGE TO A FRIEND

OR51B4

olfactory receptor, family 51, subfamily B, member 4

20 Gene Product Result for
Synonyms: HOR5'Beta1
Species: Human OR51B4(79339), Domestic Rabbit OR51B4(100328860)
UniProtKB ID: Q9Y5P0, A7MAV5, Q6NTD7
Gene ID:
Human(79339) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Domestic Rabbit(100328860) olfactory receptor, family 51, subfamily B, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302329 ANTI-OR51B4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033179 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155701 MISSION® esiRNA esiRNA human OR51B4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033179 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166028 predicted 192
2 SASI_Hs02_00360952 predicted 555
3 SASI_Hs01_00166029 predicted 472
4 SASI_Hs01_00166030 predicted 308
5 SASI_Hs01_00166031 predicted 455
6 SASI_Hs02_00360953 predicted 237
7 SASI_Hs01_00166032 predicted 198
8 SASI_Hs01_00166033 predicted 578
9 SASI_Hs01_00166035 predicted 673
10 SASI_Hs02_00360954 predicted 592
11 SASI_Hs01_00166034 predicted 386
12 SASI_Hs01_00166036 predicted 638
13 SASI_Hs01_00166037 predicted 709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033179
VALIDATED
OR51B4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily B, member 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-381s21c1
Sequence:CCGGGAGGTACAACTGCATTCTTACCTCGAGGTAAGAATGCAGTTGTACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-723s21c1
Sequence:CCGGTATTAGCTGTGTCCTAGTATTCTCGAGAATACTAGGACACAGCTAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-680s21c1
Sequence:CCGGCTGGACAAGAGGAAGCTAAATCTCGAGATTTAGCTTCCTCTTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-199s21c1
Sequence:CCGGACGGACCTTGGGATGACATTCCTCGAGGAATGTCATCCCAAGGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-476s21c1
Sequence:CCGGCACTCTACTGCTACCCATATTCTCGAGAATATGGGTAGCAGTAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-556s21c1
Sequence:CCGGTGTGCTGATATCACGTTTAATCTCGAGATTAAACGTGATATCAGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-404s21c1
Sequence:CCGGATTCCCGAGTGATGAACATAGCTCGAGCTATGTTCATCACTCGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-61s21c1
Sequence:CCGGGTTCACTACCGGATCTCTATGCTCGAGCATAGAGATCCGGTAGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-376s1c1
Sequence:CCGGCCACTGAGGTACAACTGCATTCTCGAGAATGCAGTTGTACCTCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033179.1-462s1c1
Sequence:CCGGGCCCATAATTCTTTCACTCTACTCGAGTAGAGTGAAAGAATTATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-315s1c1
Sequence:CCGGCATTGTAGAATCAGGTATCTTCTCGAGAAGATACCTGATTCTACAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-619s1c1
Sequence:CCGGGATGCTCTAATCATCATCTTTCTCGAGAAAGATGATGATTAGAGCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-554s1c1
Sequence:CCGGCCTGTGCTGATATCACGTTTACTCGAGTAAACGTGATATCAGCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033179
VALIDATED
OR51B4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily B, member 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-381s21c1
Sequence:CCGGGAGGTACAACTGCATTCTTACCTCGAGGTAAGAATGCAGTTGTACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-723s21c1
Sequence:CCGGTATTAGCTGTGTCCTAGTATTCTCGAGAATACTAGGACACAGCTAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-680s21c1
Sequence:CCGGCTGGACAAGAGGAAGCTAAATCTCGAGATTTAGCTTCCTCTTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-199s21c1
Sequence:CCGGACGGACCTTGGGATGACATTCCTCGAGGAATGTCATCCCAAGGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-476s21c1
Sequence:CCGGCACTCTACTGCTACCCATATTCTCGAGAATATGGGTAGCAGTAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-556s21c1
Sequence:CCGGTGTGCTGATATCACGTTTAATCTCGAGATTAAACGTGATATCAGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-404s21c1
Sequence:CCGGATTCCCGAGTGATGAACATAGCTCGAGCTATGTTCATCACTCGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-61s21c1
Sequence:CCGGGTTCACTACCGGATCTCTATGCTCGAGCATAGAGATCCGGTAGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-376s1c1
Sequence:CCGGCCACTGAGGTACAACTGCATTCTCGAGAATGCAGTTGTACCTCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033179.1-462s1c1
Sequence:CCGGGCCCATAATTCTTTCACTCTACTCGAGTAGAGTGAAAGAATTATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-315s1c1
Sequence:CCGGCATTGTAGAATCAGGTATCTTCTCGAGAAGATACCTGATTCTACAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-619s1c1
Sequence:CCGGGATGCTCTAATCATCATCTTTCTCGAGAAAGATGATGATTAGAGCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-554s1c1
Sequence:CCGGCCTGTGCTGATATCACGTTTACTCGAGTAAACGTGATATCAGCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033179
VALIDATED
OR51B4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily B, member 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-381s21c1
Sequence:CCGGGAGGTACAACTGCATTCTTACCTCGAGGTAAGAATGCAGTTGTACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-723s21c1
Sequence:CCGGTATTAGCTGTGTCCTAGTATTCTCGAGAATACTAGGACACAGCTAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-680s21c1
Sequence:CCGGCTGGACAAGAGGAAGCTAAATCTCGAGATTTAGCTTCCTCTTGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-199s21c1
Sequence:CCGGACGGACCTTGGGATGACATTCCTCGAGGAATGTCATCCCAAGGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-476s21c1
Sequence:CCGGCACTCTACTGCTACCCATATTCTCGAGAATATGGGTAGCAGTAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-556s21c1
Sequence:CCGGTGTGCTGATATCACGTTTAATCTCGAGATTAAACGTGATATCAGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-404s21c1
Sequence:CCGGATTCCCGAGTGATGAACATAGCTCGAGCTATGTTCATCACTCGGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033179.2-61s21c1
Sequence:CCGGGTTCACTACCGGATCTCTATGCTCGAGCATAGAGATCCGGTAGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-376s1c1
Sequence:CCGGCCACTGAGGTACAACTGCATTCTCGAGAATGCAGTTGTACCTCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_033179.1-462s1c1
Sequence:CCGGGCCCATAATTCTTTCACTCTACTCGAGTAGAGTGAAAGAATTATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-315s1c1
Sequence:CCGGCATTGTAGAATCAGGTATCTTCTCGAGAAGATACCTGATTCTACAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-619s1c1
Sequence:CCGGGATGCTCTAATCATCATCTTTCTCGAGAAAGATGATGATTAGAGCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033179.1-554s1c1
Sequence:CCGGCCTGTGCTGATATCACGTTTACTCGAGTAAACGTGATATCAGCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)