EMAIL THIS PAGE TO A FRIEND

OR51B5

olfactory receptor, family 51, subfamily B, member 5

19 Gene Product Result for
Synonyms: HOR5'Beta5 OR11-37
UniProtKB ID: Q9H339, B2RN59
Gene ID:
Human(282763) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(100683161) olfactory receptor, family 51, subfamily B, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005567 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055981 MISSION® esiRNA esiRNA human OR51B5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005567 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059984 predicted 522
2 SASI_Hs01_00059985 predicted 636
3 SASI_Hs01_00059987 predicted 582
4 SASI_Hs01_00059988 predicted 639
5 SASI_Hs01_00059989 predicted 624
6 SASI_Hs01_00059990 predicted 495
7 SASI_Hs01_00059992 predicted 321
8 SASI_Hs01_00059993 predicted 394
9 SASI_Hs02_00304990 predicted 287
10 SASI_Hs02_00304991 predicted 522
11 SASI_Hs01_00059986 predicted 376
12 SASI_Hs01_00059991 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005567
OR51B5 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily B, member 5
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000187243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005567.1-493s1c1
Sequence:CCGGCTGTATTGTCACTCCCATGTTCTCGAGAACATGGGAGTGACAATACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005567.1-379s1c1
Sequence:CCGGCCTCTTAGATATACCTCTGTACTCGAGTACAGAGGTATATCTAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005567
OR51B5 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily B, member 5
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000187243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005567.1-493s1c1
Sequence:CCGGCTGTATTGTCACTCCCATGTTCTCGAGAACATGGGAGTGACAATACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005567.1-379s1c1
Sequence:CCGGCCTCTTAGATATACCTCTGTACTCGAGTACAGAGGTATATCTAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005567
OR51B5 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily B, member 5
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000187243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005567.1-493s1c1
Sequence:CCGGCTGTATTGTCACTCCCATGTTCTCGAGAACATGGGAGTGACAATACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005567.1-379s1c1
Sequence:CCGGCCTCTTAGATATACCTCTGTACTCGAGTACAGAGGTATATCTAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)