EMAIL THIS PAGE TO A FRIEND

OR51E1

olfactory receptor, family 51, subfamily E, member 1

26 Gene Product Result for
Synonyms: D-GPCR DGPCR GPR136 GPR164 OR51E1P OR52A3P POGR PSGR2
UniProtKB ID: Q8TCB6, A8KAM6, Q5S4P5, Q66X57, Q6IF93
Gene ID:
Human(143503) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(526623) olfactory receptor, family 51, subfamily E, member 1
Domestic Rabbit(100328817) olfactory receptor, family 51, subfamily E, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152430 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135684 predicted 223
2 SASI_Hs01_00135685 predicted 911
3 SASI_Hs01_00135686 predicted 265
4 SASI_Hs01_00135687 predicted 475
5 SASI_Hs01_00135688 predicted 771
6 SASI_Hs01_00135689 predicted 518
7 SASI_Hs01_00135690 predicted 239
8 SASI_Hs01_00135691 predicted 311
9 SASI_Hs01_00135692 predicted 384
10 SASI_Hs02_00366169 predicted 318
11 SASI_Hs01_00135693 predicted 791
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152430
OR51E1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily E, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-270s1c1
Sequence:CCGGGCTAGGTAACTTGACAATCATCTCGAGATGATTGTCAAGTTACCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-889s1c1
Sequence:CCGGGCTGTGTTCATATTCTATGTACTCGAGTACATAGAATATGAACACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-439s1c1
Sequence:CCGGGCTTGTCTGCTACAGATGTTTCTCGAGAAACATCTGTAGCAGACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-744s1c1
Sequence:CCGGCTATGGCCTTATCGTCATCATCTCGAGATGATGACGATAAGGCCATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-661s1c1
Sequence:CCGGCGCTCCAATATCCTTTCCCATCTCGAGATGGGAAAGGATATTGGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152430.3-923s21c1
Sequence:CCGGTGTCCATGGTGCATCGCTTTACTCGAGTAAAGCGATGCACCATGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152430.3-1314s21c1
Sequence:CCGGGTTGTGGTTGGAGGGTTATTACTCGAGTAATAACCCTCCAACCACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152430.3-728s21c1
Sequence:CCGGTCCGGGTCAATGTCGTCTATGCTCGAGCATAGACGACATTGACCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152430.3-1097s21c1
Sequence:CCGGCCTAGGTGTCAGTGATCAAACCTCGAGGTTTGATCACTGACACCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152430
OR51E1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily E, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-270s1c1
Sequence:CCGGGCTAGGTAACTTGACAATCATCTCGAGATGATTGTCAAGTTACCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-889s1c1
Sequence:CCGGGCTGTGTTCATATTCTATGTACTCGAGTACATAGAATATGAACACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-439s1c1
Sequence:CCGGGCTTGTCTGCTACAGATGTTTCTCGAGAAACATCTGTAGCAGACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-744s1c1
Sequence:CCGGCTATGGCCTTATCGTCATCATCTCGAGATGATGACGATAAGGCCATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-661s1c1
Sequence:CCGGCGCTCCAATATCCTTTCCCATCTCGAGATGGGAAAGGATATTGGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152430.3-923s21c1
Sequence:CCGGTGTCCATGGTGCATCGCTTTACTCGAGTAAAGCGATGCACCATGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152430.3-1314s21c1
Sequence:CCGGGTTGTGGTTGGAGGGTTATTACTCGAGTAATAACCCTCCAACCACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152430.3-728s21c1
Sequence:CCGGTCCGGGTCAATGTCGTCTATGCTCGAGCATAGACGACATTGACCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152430.3-1097s21c1
Sequence:CCGGCCTAGGTGTCAGTGATCAAACCTCGAGGTTTGATCACTGACACCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152430
OR51E1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily E, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-270s1c1
Sequence:CCGGGCTAGGTAACTTGACAATCATCTCGAGATGATTGTCAAGTTACCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-889s1c1
Sequence:CCGGGCTGTGTTCATATTCTATGTACTCGAGTACATAGAATATGAACACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-439s1c1
Sequence:CCGGGCTTGTCTGCTACAGATGTTTCTCGAGAAACATCTGTAGCAGACAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-744s1c1
Sequence:CCGGCTATGGCCTTATCGTCATCATCTCGAGATGATGACGATAAGGCCATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152430.1-661s1c1
Sequence:CCGGCGCTCCAATATCCTTTCCCATCTCGAGATGGGAAAGGATATTGGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152430.3-923s21c1
Sequence:CCGGTGTCCATGGTGCATCGCTTTACTCGAGTAAAGCGATGCACCATGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152430.3-1314s21c1
Sequence:CCGGGTTGTGGTTGGAGGGTTATTACTCGAGTAATAACCCTCCAACCACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152430.3-728s21c1
Sequence:CCGGTCCGGGTCAATGTCGTCTATGCTCGAGCATAGACGACATTGACCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152430.3-1097s21c1
Sequence:CCGGCCTAGGTGTCAGTGATCAAACCTCGAGGTTTGATCACTGACACCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)