EMAIL THIS PAGE TO A FRIEND

OR51E2

olfactory receptor, family 51, subfamily E, member 2

27 Gene Product Result for
Synonyms: OR51E3P OR52A2 PSGR
UniProtKB ID: Q9H255, B2RA63, Q6IF94
Gene ID:
Human(81285) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Domestic Rabbit(100328820) olfactory receptor, family 51, subfamily E, member 2
cow(510115) olfactory receptor, family 51, subfamily E, member 2
dog(485238) cOR51E4 olfactory receptor family 51 subfamily E-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503227 Anti-OR51E2 antibody produced in rabbit affinity isolated antibody human, rat
ELISA, immunofluorescence, western blot pricing
P7497 Anti-Prostate-Specific G Protein-Coupled Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030774 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044941 MISSION® esiRNA esiRNA human OR51E2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030774 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188890 predicted 980
2 SASI_Hs01_00188891 predicted 1193
3 SASI_Hs01_00188892 predicted 1263
4 SASI_Hs01_00188893 predicted 1233
5 SASI_Hs01_00188894 predicted 302
6 SASI_Hs01_00188895 predicted 330
7 SASI_Hs01_00188896 predicted 260
8 SASI_Hs01_00188897 predicted 990
9 SASI_Hs01_00188898 predicted 354
10 SASI_Hs01_00188899 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030774
OR51E2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily E, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030774.3-1520s21c1
Sequence:CCGGTTTAGTGTTGTCCCTACTTTCCTCGAGGAAAGTAGGGACAACACTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030774.3-990s21c1
Sequence:CCGGCCTTCTATGTGCCACTTATTGCTCGAGCAATAAGTGGCACATAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030774.2-638s1c1
Sequence:CCGGGCAGTGCTCAACAATACAGTACTCGAGTACTGTATTGTTGAGCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030774.2-2180s1c1
Sequence:CCGGGCCCTTAATAATAATGCCAATCTCGAGATTGGCATTATTATTAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030774.3-1342s21c1
Sequence:CCGGATCTACCTAAAGGACTATTATCTCGAGATAATAGTCCTTTAGGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030774.2-290s1c1
Sequence:CCGGCCAGGATTAGAGAAAGCCCATCTCGAGATGGGCTTTCTCTAATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030774.2-986s1c1
Sequence:CCGGGCCTTCTATGTGCCACTTATTCTCGAGAATAAGTGGCACATAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030774.3-498s21c1
Sequence:CCGGGGTTTGATTCCCGAGAGATTACTCGAGTAATCTCTCGGGAATCAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030774
OR51E2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily E, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030774.3-1520s21c1
Sequence:CCGGTTTAGTGTTGTCCCTACTTTCCTCGAGGAAAGTAGGGACAACACTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030774.3-990s21c1
Sequence:CCGGCCTTCTATGTGCCACTTATTGCTCGAGCAATAAGTGGCACATAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030774.2-638s1c1
Sequence:CCGGGCAGTGCTCAACAATACAGTACTCGAGTACTGTATTGTTGAGCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030774.2-2180s1c1
Sequence:CCGGGCCCTTAATAATAATGCCAATCTCGAGATTGGCATTATTATTAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030774.3-1342s21c1
Sequence:CCGGATCTACCTAAAGGACTATTATCTCGAGATAATAGTCCTTTAGGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030774.2-290s1c1
Sequence:CCGGCCAGGATTAGAGAAAGCCCATCTCGAGATGGGCTTTCTCTAATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030774.2-986s1c1
Sequence:CCGGGCCTTCTATGTGCCACTTATTCTCGAGAATAAGTGGCACATAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030774.3-498s21c1
Sequence:CCGGGGTTTGATTCCCGAGAGATTACTCGAGTAATCTCTCGGGAATCAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030774
OR51E2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily E, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030774.3-1520s21c1
Sequence:CCGGTTTAGTGTTGTCCCTACTTTCCTCGAGGAAAGTAGGGACAACACTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030774.3-990s21c1
Sequence:CCGGCCTTCTATGTGCCACTTATTGCTCGAGCAATAAGTGGCACATAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030774.2-638s1c1
Sequence:CCGGGCAGTGCTCAACAATACAGTACTCGAGTACTGTATTGTTGAGCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009411    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030774.2-2180s1c1
Sequence:CCGGGCCCTTAATAATAATGCCAATCTCGAGATTGGCATTATTATTAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030774.3-1342s21c1
Sequence:CCGGATCTACCTAAAGGACTATTATCTCGAGATAATAGTCCTTTAGGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030774.2-290s1c1
Sequence:CCGGCCAGGATTAGAGAAAGCCCATCTCGAGATGGGCTTTCTCTAATCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030774.2-986s1c1
Sequence:CCGGGCCTTCTATGTGCCACTTATTCTCGAGAATAAGTGGCACATAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030774.3-498s21c1
Sequence:CCGGGGTTTGATTCCCGAGAGATTACTCGAGTAATCTCTCGGGAATCAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)