EMAIL THIS PAGE TO A FRIEND

OR51F1

olfactory receptor, family 51, subfamily F, member 1

15 Gene Product Result for
Synonyms: OR11-21 OR51F1P
UniProtKB ID: A6NGY5
Gene ID:
Human(256892) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(504569) olfactory receptor, family 51, subfamily F, member 1
Domestic Rabbit(100328824) olfactory receptor 51F1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304051 ANTI-OR51F1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4501072 Anti-OR51F1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_171424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_171424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_171424 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004752 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084539 predicted 456
2 SASI_Hs01_00084540 predicted 404
3 SASI_Hs01_00084541 predicted 280
4 SASI_Hs01_00084543 predicted 251
5 SASI_Hs01_00084544 predicted 569
6 SASI_Hs01_00084545 predicted 238
7 SASI_Hs01_00084546 predicted 552
8 SASI_Hs01_00084547 predicted 271
9 SASI_Hs01_00084548 predicted 558
10 SASI_Hs02_00304702 predicted 527
11 SASI_Hs01_00084542 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_171424
OR51F1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily F, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000187657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-167s1c1
Sequence:CCGGGTCTCCATGAACCCATGTATTCTCGAGAATACATGGGTTCATGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-562s1c1
Sequence:CCGGCAATTAGCATGTTCAGACATTCTCGAGAATGTCTGAACATGCTAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-623s1c1
Sequence:CCGGCCACTGGAATAGATACACCATCTCGAGATGGTGTATCTATTCCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-640s1c1
Sequence:CCGGCCATGCATTGTCCTGTCATATCTCGAGATATGACAGGACAATGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-498s1c1
Sequence:CCGGGCCTCTCTATTTCTGTAGAATCTCGAGATTCTACAGAAATAGAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-391s1c1
Sequence:CCGGCCTCTGAGGTACACTACCATTCTCGAGAATGGTAGTGTACCTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-586s1c1
Sequence:CCGGGCAAATAGCATCTGTGGATTACTCGAGTAATCCACAGATGCTATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-135s1c1
Sequence:CCGGCGTGATCCTGTTTGTCATCATCTCGAGATGATGACAAACAGGATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-587s1c1
Sequence:CCGGCAAATAGCATCTGTGGATTAACTCGAGTTAATCCACAGATGCTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_171424
OR51F1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily F, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000187657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-167s1c1
Sequence:CCGGGTCTCCATGAACCCATGTATTCTCGAGAATACATGGGTTCATGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-562s1c1
Sequence:CCGGCAATTAGCATGTTCAGACATTCTCGAGAATGTCTGAACATGCTAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-623s1c1
Sequence:CCGGCCACTGGAATAGATACACCATCTCGAGATGGTGTATCTATTCCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-640s1c1
Sequence:CCGGCCATGCATTGTCCTGTCATATCTCGAGATATGACAGGACAATGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-498s1c1
Sequence:CCGGGCCTCTCTATTTCTGTAGAATCTCGAGATTCTACAGAAATAGAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-391s1c1
Sequence:CCGGCCTCTGAGGTACACTACCATTCTCGAGAATGGTAGTGTACCTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-586s1c1
Sequence:CCGGGCAAATAGCATCTGTGGATTACTCGAGTAATCCACAGATGCTATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-135s1c1
Sequence:CCGGCGTGATCCTGTTTGTCATCATCTCGAGATGATGACAAACAGGATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-587s1c1
Sequence:CCGGCAAATAGCATCTGTGGATTAACTCGAGTTAATCCACAGATGCTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_171424
OR51F1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily F, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000187657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-167s1c1
Sequence:CCGGGTCTCCATGAACCCATGTATTCTCGAGAATACATGGGTTCATGGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-562s1c1
Sequence:CCGGCAATTAGCATGTTCAGACATTCTCGAGAATGTCTGAACATGCTAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-623s1c1
Sequence:CCGGCCACTGGAATAGATACACCATCTCGAGATGGTGTATCTATTCCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-640s1c1
Sequence:CCGGCCATGCATTGTCCTGTCATATCTCGAGATATGACAGGACAATGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-498s1c1
Sequence:CCGGGCCTCTCTATTTCTGTAGAATCTCGAGATTCTACAGAAATAGAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-391s1c1
Sequence:CCGGCCTCTGAGGTACACTACCATTCTCGAGAATGGTAGTGTACCTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-586s1c1
Sequence:CCGGGCAAATAGCATCTGTGGATTACTCGAGTAATCCACAGATGCTATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-135s1c1
Sequence:CCGGCGTGATCCTGTTTGTCATCATCTCGAGATGATGACAAACAGGATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171424.1-587s1c1
Sequence:CCGGCAAATAGCATCTGTGGATTAACTCGAGTTAATCCACAGATGCTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)