EMAIL THIS PAGE TO A FRIEND

OR51L1

olfactory receptor, family 51, subfamily L, member 1

14 Gene Product Result for
Synonyms: OR11-31
Species: Human OR51L1(119682), Domestic Rabbit OR51L1(100328836)
UniProtKB ID: Q8NGJ5, Q6IFE5
Gene ID:
Human(119682) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Domestic Rabbit(100328836) olfactory receptor, family 51, subfamily L, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302213 ANTI-OR51L1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_061614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_061614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_061614 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004755 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040627 predicted 583
2 SASI_Hs02_00304706 predicted 703
3 SASI_Hs01_00040628 predicted 520
4 SASI_Hs01_00040629 predicted 549
5 SASI_Hs01_00040630 predicted 476
6 SASI_Hs01_00040631 predicted 639
7 SASI_Hs01_00040632 predicted 674
8 SASI_Hs01_00040634 predicted 479
9 SASI_Hs01_00040635 predicted 290
10 SASI_Hs01_00040636 predicted 584
11 SASI_Hs01_00040633 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_061614
OR51L1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily L, member 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000204444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061614.1-242s1c1
Sequence:CCGGCCACCATGCTTGCTGTGTTATCTCGAGATAACACAGCAAGCATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061614.1-245s1c1
Sequence:CCGGCCATGCTTGCTGTGTTATGGTCTCGAGACCATAACACAGCAAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_061614
OR51L1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily L, member 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000204444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061614.1-242s1c1
Sequence:CCGGCCACCATGCTTGCTGTGTTATCTCGAGATAACACAGCAAGCATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061614.1-245s1c1
Sequence:CCGGCCATGCTTGCTGTGTTATGGTCTCGAGACCATAACACAGCAAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_061614
OR51L1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily L, member 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000204444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061614.1-242s1c1
Sequence:CCGGCCACCATGCTTGCTGTGTTATCTCGAGATAACACAGCAAGCATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061614.1-245s1c1
Sequence:CCGGCCATGCTTGCTGTGTTATGGTCTCGAGACCATAACACAGCAAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)