EMAIL THIS PAGE TO A FRIEND

OR51M1

olfactory receptor, family 51, subfamily M, member 1

18 Gene Product Result for
Synonyms: HOR5'Beta7 OR11-40
UniProtKB ID: Q9H341, Q6IF80
Gene ID:
Human(390059) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Domestic Rabbit(100328863) olfactory receptor, family 51, subfamily M, member 1
chicken(428116) olfactory receptor, family 51, subfamily M, member 1
cow(617886) olfactory receptor, family 51, subfamily M, member 1
dog(485261) olfactory receptor, family 51, subfamily M, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372354 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151021 MISSION® esiRNA esiRNA human OR51M1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004756 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203115 predicted 603
2 SASI_Hs01_00203117 predicted 288
3 SASI_Hs01_00203118 predicted 413
4 SASI_Hs01_00203119 predicted 598
5 SASI_Hs01_00203120 predicted 321
6 SASI_Hs01_00203121 predicted 624
7 SASI_Hs01_00203122 predicted 676
8 SASI_Hs01_00203123 predicted 198
9 SASI_Hs02_00304707 predicted 306
10 SASI_Hs02_00304708 predicted 507
11 SASI_Hs01_00203114 predicted 333
12 SASI_Hs01_00203116 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372354
OR51M1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily M, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000187535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-266s1c1
Sequence:CCGGGCATGGCAACAAGTAACCAAACTCGAGTTTGGTTACTTGTTGCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-363s1c1
Sequence:CCGGCCGAGGAATGTCAGTCCAATACTCGAGTATTGGACTGACATTCCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-790s1c1
Sequence:CCGGCCTCTGAGGTATTCGGTCATTCTCGAGAATGACCGAATACCTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-364s1c1
Sequence:CCGGCGAGGAATGTCAGTCCAATATCTCGAGATATTGGACTGACATTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-1149s1c1
Sequence:CCGGGCTAGTATTCTTTGTGCCCATCTCGAGATGGGCACAAAGAATACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-267s1c2
Sequence:CCGGCATGGCAACAAGTAACCAAATCTCGAGATTTGGTTACTTGTTGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372354
OR51M1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily M, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000187535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-266s1c1
Sequence:CCGGGCATGGCAACAAGTAACCAAACTCGAGTTTGGTTACTTGTTGCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-363s1c1
Sequence:CCGGCCGAGGAATGTCAGTCCAATACTCGAGTATTGGACTGACATTCCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-790s1c1
Sequence:CCGGCCTCTGAGGTATTCGGTCATTCTCGAGAATGACCGAATACCTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-364s1c1
Sequence:CCGGCGAGGAATGTCAGTCCAATATCTCGAGATATTGGACTGACATTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-1149s1c1
Sequence:CCGGGCTAGTATTCTTTGTGCCCATCTCGAGATGGGCACAAAGAATACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-267s1c2
Sequence:CCGGCATGGCAACAAGTAACCAAATCTCGAGATTTGGTTACTTGTTGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372354
OR51M1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily M, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000187535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-266s1c1
Sequence:CCGGGCATGGCAACAAGTAACCAAACTCGAGTTTGGTTACTTGTTGCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-363s1c1
Sequence:CCGGCCGAGGAATGTCAGTCCAATACTCGAGTATTGGACTGACATTCCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-790s1c1
Sequence:CCGGCCTCTGAGGTATTCGGTCATTCTCGAGAATGACCGAATACCTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-364s1c1
Sequence:CCGGCGAGGAATGTCAGTCCAATATCTCGAGATATTGGACTGACATTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-1149s1c1
Sequence:CCGGGCTAGTATTCTTTGTGCCCATCTCGAGATGGGCACAAAGAATACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372354.1-267s1c2
Sequence:CCGGCATGGCAACAAGTAACCAAATCTCGAGATTTGGTTACTTGTTGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)