EMAIL THIS PAGE TO A FRIEND

OR51Q1

olfactory receptor, family 51, subfamily Q, member 1

17 Gene Product Result for
UniProtKB ID: Q8NH59, B2RNN1
Gene ID:
Human(390061) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(485265) cOR51Q3 olfactory receptor family 51 subfamily Q-like
cow(511284) olfactory receptor, family 51, subfamily Q, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372355 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031181 MISSION® esiRNA esiRNA human OR51Q1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004757 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141934 predicted 526
2 SASI_Hs01_00141935 predicted 255
3 SASI_Hs01_00141936 predicted 320
4 SASI_Hs01_00141937 predicted 256
5 SASI_Hs01_00141938 predicted 549
6 SASI_Hs01_00141939 predicted 335
7 SASI_Hs01_00141940 predicted 422
8 SASI_Hs01_00141941 predicted 422
9 SASI_Hs01_00141942 predicted 643
10 SASI_Hs01_00141943 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372355
OR51Q1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily Q, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-640s1c1
Sequence:CCGGCTGCTCATTGTGATCTCCTATCTCGAGATAGGAGATCACAATGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-607s1c1
Sequence:CCGGGCTCTTGCCTTGCTCATTATTCTCGAGAATAATGAGCAAGGCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-172s1c1
Sequence:CCGGCACCAGCGCATGTATCTGTTTCTCGAGAAACAGATACATGCGCTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-585s1c1
Sequence:CCGGGCTCAACAGCTGGTATGGATTCTCGAGAATCCATACCAGCTGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372355
OR51Q1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily Q, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-640s1c1
Sequence:CCGGCTGCTCATTGTGATCTCCTATCTCGAGATAGGAGATCACAATGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-607s1c1
Sequence:CCGGGCTCTTGCCTTGCTCATTATTCTCGAGAATAATGAGCAAGGCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-172s1c1
Sequence:CCGGCACCAGCGCATGTATCTGTTTCTCGAGAAACAGATACATGCGCTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-585s1c1
Sequence:CCGGGCTCAACAGCTGGTATGGATTCTCGAGAATCCATACCAGCTGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372355
OR51Q1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily Q, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-640s1c1
Sequence:CCGGCTGCTCATTGTGATCTCCTATCTCGAGATAGGAGATCACAATGAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-607s1c1
Sequence:CCGGGCTCTTGCCTTGCTCATTATTCTCGAGAATAATGAGCAAGGCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-172s1c1
Sequence:CCGGCACCAGCGCATGTATCTGTTTCTCGAGAAACAGATACATGCGCTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372355.1-585s1c1
Sequence:CCGGGCTCAACAGCTGGTATGGATTCTCGAGAATCCATACCAGCTGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)