EMAIL THIS PAGE TO A FRIEND

OR51T1

olfactory receptor, family 51, subfamily T, member 1

27 Gene Product Result for
Synonyms: OR11-26
UniProtKB ID: Q8NGJ9, Q6IFH9
Gene ID:
Human(401665) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Rat(502357) olfactory receptor, family 51, subfamily T, member 1
cow(782473) olfactory receptor, family 51, subfamily T, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004759 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004759 Rosetta Predictions human pricing
XM_577827 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236341 predicted 594
2 SASI_Hs01_00236342 predicted 675
3 SASI_Hs01_00236343 predicted 357
4 SASI_Hs01_00236344 predicted 204
5 SASI_Hs01_00236345 predicted 453
6 SASI_Hs01_00236346 predicted 703
7 SASI_Hs01_00236347 predicted 561
8 SASI_Hs01_00236349 predicted 702
9 SASI_Hs01_00236350 predicted 477
10 SASI_Hs02_00304710 predicted 568
11 SASI_Hs01_00236348 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407158 predicted 794
2 SASI_Rn02_00407159 predicted 602
3 SASI_Rn02_00407160 predicted 881
4 SASI_Rn02_00407161 predicted 782
5 SASI_Rn02_00407162 predicted 944
6 SASI_Rn02_00407163 predicted 600
7 SASI_Rn02_00407164 predicted 681
8 SASI_Rn02_00407165 predicted 446
9 SASI_Rn02_00407166 predicted 447
10 SASI_Rn02_00407167 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004759
OR51T1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily T, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-471s1c1
Sequence:CCGGCCCACTGAACTATGCTACTATCTCGAGATAGTAGCATAGTTCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-201s1c1
Sequence:CCGGCCTCTTGGGAAACAGTATGATCTCGAGATCATACTGTTTCCCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-99s1c1
Sequence:CCGGCACCACTTCGTCTTCCTCAAACTCGAGTTTGAGGAAGACGAAGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-903s1c1
Sequence:CCGGCTGTAGCACTTTGGCCAATATCTCGAGATATTGGCCAAAGTGCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-627s1c1
Sequence:CCGGCCACCCAGAAGTGATCAAATACTCGAGTATTTGATCACTTCTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004759
OR51T1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily T, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-471s1c1
Sequence:CCGGCCCACTGAACTATGCTACTATCTCGAGATAGTAGCATAGTTCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-201s1c1
Sequence:CCGGCCTCTTGGGAAACAGTATGATCTCGAGATCATACTGTTTCCCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-99s1c1
Sequence:CCGGCACCACTTCGTCTTCCTCAAACTCGAGTTTGAGGAAGACGAAGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-903s1c1
Sequence:CCGGCTGTAGCACTTTGGCCAATATCTCGAGATATTGGCCAAAGTGCTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-627s1c1
Sequence:CCGGCCACCCAGAAGTGATCAAATACTCGAGTATTTGATCACTTCTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004759
OR51T1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily T, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-471s1c1
Sequence:CCGGCCCACTGAACTATGCTACTATCTCGAGATAGTAGCATAGTTCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-201s1c1
Sequence:CCGGCCTCTTGGGAAACAGTATGATCTCGAGATCATACTGTTTCCCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-99s1c1
Sequence:CCGGCACCACTTCGTCTTCCTCAAACTCGAGTTTGAGGAAGACGAAGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-903s1c1
Sequence:CCGGCTGTAGCACTTTGGCCAATATCTCGAGATATTGGCCAAAGTGCTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004759.1-627s1c1
Sequence:CCGGCCACCCAGAAGTGATCAAATACTCGAGTATTTGATCACTTCTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)