EMAIL THIS PAGE TO A FRIEND

OR52A1

olfactory receptor, family 52, subfamily A, member 1

19 Gene Product Result for
Synonyms: HPFH1OR
Species: Human OR52A1(23538)
UniProtKB ID: Q9UKL2, Q6IF31
Gene ID:
Human(23538) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303830 ANTI-OR52A1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4500999 Anti-OR52A1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012375 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164634 predicted 422
2 SASI_Hs01_00164635 predicted 542
3 SASI_Hs01_00164637 predicted 259
4 SASI_Hs01_00164638 predicted 373
5 SASI_Hs01_00164640 predicted 423
6 SASI_Hs01_00164641 predicted 515
7 SASI_Hs01_00164643 predicted 599
8 SASI_Hs02_00344172 predicted 546
9 SASI_Hs01_00164636 predicted 237
10 SASI_Hs02_00344173 predicted 627
11 SASI_Hs01_00164639 predicted 625
12 SASI_Hs01_00164642 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012375
OR52A1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily A, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-209s1c1
Sequence:CCGGCCACAGACATTGCACTTGCTACTCGAGTAGCAAGTGCAATGTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-487s1c1
Sequence:CCGGGTACTGATAAAGTGCCGGTTTCTCGAGAAACCGGCACTTTATCAGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-297s1c1
Sequence:CCGGCTTGCTTCAAATGTGGTTCATCTCGAGATGAACCACATTTGAAGCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-31s1c1
Sequence:CCGGCCCTCTGTGTTGACACTAGTACTCGAGTACTAGTGTCAACACAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-706s1c1
Sequence:CCGGGCTAGGTTTAAAGCATTCAATCTCGAGATTGAATGCTTTAAACCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-317s21c1
Sequence:CCGGTCCACACATTGCAGGGTATAGCTCGAGCTATACCCTGCAATGTGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-655s21c1
Sequence:CCGGTTGTCCTACATCCAGATATTTCTCGAGAAATATCTGGATGTAGGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-696s21c1
Sequence:CCGGCCAGAAGGAGGCTAGGTTTAACTCGAGTTAAACCTAGCCTCCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-250s21c1
Sequence:CCGGCTTGGAATATTCTGGTTTAATCTCGAGATTAAACCAGAATATTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012375
OR52A1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily A, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-209s1c1
Sequence:CCGGCCACAGACATTGCACTTGCTACTCGAGTAGCAAGTGCAATGTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-487s1c1
Sequence:CCGGGTACTGATAAAGTGCCGGTTTCTCGAGAAACCGGCACTTTATCAGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-297s1c1
Sequence:CCGGCTTGCTTCAAATGTGGTTCATCTCGAGATGAACCACATTTGAAGCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-31s1c1
Sequence:CCGGCCCTCTGTGTTGACACTAGTACTCGAGTACTAGTGTCAACACAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-706s1c1
Sequence:CCGGGCTAGGTTTAAAGCATTCAATCTCGAGATTGAATGCTTTAAACCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-317s21c1
Sequence:CCGGTCCACACATTGCAGGGTATAGCTCGAGCTATACCCTGCAATGTGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-655s21c1
Sequence:CCGGTTGTCCTACATCCAGATATTTCTCGAGAAATATCTGGATGTAGGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-696s21c1
Sequence:CCGGCCAGAAGGAGGCTAGGTTTAACTCGAGTTAAACCTAGCCTCCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-250s21c1
Sequence:CCGGCTTGGAATATTCTGGTTTAATCTCGAGATTAAACCAGAATATTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012375
OR52A1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily A, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-209s1c1
Sequence:CCGGCCACAGACATTGCACTTGCTACTCGAGTAGCAAGTGCAATGTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-487s1c1
Sequence:CCGGGTACTGATAAAGTGCCGGTTTCTCGAGAAACCGGCACTTTATCAGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-297s1c1
Sequence:CCGGCTTGCTTCAAATGTGGTTCATCTCGAGATGAACCACATTTGAAGCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-31s1c1
Sequence:CCGGCCCTCTGTGTTGACACTAGTACTCGAGTACTAGTGTCAACACAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012375.1-706s1c1
Sequence:CCGGGCTAGGTTTAAAGCATTCAATCTCGAGATTGAATGCTTTAAACCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-317s21c1
Sequence:CCGGTCCACACATTGCAGGGTATAGCTCGAGCTATACCCTGCAATGTGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-655s21c1
Sequence:CCGGTTGTCCTACATCCAGATATTTCTCGAGAAATATCTGGATGTAGGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-696s21c1
Sequence:CCGGCCAGAAGGAGGCTAGGTTTAACTCGAGTTAAACCTAGCCTCCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012375.2-250s21c1
Sequence:CCGGCTTGGAATATTCTGGTTTAATCTCGAGATTAAACCAGAATATTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)