EMAIL THIS PAGE TO A FRIEND

OR52B2

olfactory receptor, family 52, subfamily B, member 2

14 Gene Product Result for
Synonyms: OR11-70
UniProtKB ID: Q96RD2, Q8NGM7
Gene ID:
Human(255725) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
chicken(428110) olfactory receptor, family 52, subfamily B, member 2
cow(507282) olfactory receptor, family 52, subfamily B, member 2
dog(485330) cOR52B2 olfactory receptor family 52 subfamily B-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501065 Anti-OR52B2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_171528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_171528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_171528 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004052 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134270 predicted 429
2 SASI_Hs01_00134271 predicted 474
3 SASI_Hs01_00134272 predicted 581
4 SASI_Hs02_00304446 predicted 295
5 SASI_Hs01_00134273 predicted 337
6 SASI_Hs01_00134274 predicted 655
7 SASI_Hs01_00134275 predicted 732
8 SASI_Hs01_00134276 predicted 469
9 SASI_Hs01_00134277 predicted 504
10 SASI_Hs01_00134278 predicted 550
11 SASI_Hs01_00134279 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_171528
OR52B2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily B, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-477s1c1
Sequence:CCGGCCCAGTCATATTCTTGCTGAACTCGAGTTCAGCAAGAATATGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-71s1c1
Sequence:CCGGCTTATCACATTTGGCTGTCAACTCGAGTTGACAGCCAAATGTGATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-619s1c1
Sequence:CCGGGTCATGGTCATCTTGGATGTTCTCGAGAACATCCAAGATGACCATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-735s1c1
Sequence:CCGGCCACCTCTGTGTCATCCTTATCTCGAGATAAGGATGACACAGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-302s1c1
Sequence:CCGGCCCAAGGCTTCTTTGTCCATACTCGAGTATGGACAAAGAAGCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_171528
OR52B2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily B, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-477s1c1
Sequence:CCGGCCCAGTCATATTCTTGCTGAACTCGAGTTCAGCAAGAATATGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-71s1c1
Sequence:CCGGCTTATCACATTTGGCTGTCAACTCGAGTTGACAGCCAAATGTGATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-619s1c1
Sequence:CCGGGTCATGGTCATCTTGGATGTTCTCGAGAACATCCAAGATGACCATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-735s1c1
Sequence:CCGGCCACCTCTGTGTCATCCTTATCTCGAGATAAGGATGACACAGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-302s1c1
Sequence:CCGGCCCAAGGCTTCTTTGTCCATACTCGAGTATGGACAAAGAAGCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_171528
OR52B2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily B, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-477s1c1
Sequence:CCGGCCCAGTCATATTCTTGCTGAACTCGAGTTCAGCAAGAATATGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-71s1c1
Sequence:CCGGCTTATCACATTTGGCTGTCAACTCGAGTTGACAGCCAAATGTGATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-619s1c1
Sequence:CCGGGTCATGGTCATCTTGGATGTTCTCGAGAACATCCAAGATGACCATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-735s1c1
Sequence:CCGGCCACCTCTGTGTCATCCTTATCTCGAGATAAGGATGACACAGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_171528.1-302s1c1
Sequence:CCGGCCCAAGGCTTCTTTGTCCATACTCGAGTATGGACAAAGAAGCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)