EMAIL THIS PAGE TO A FRIEND

OR52B4

olfactory receptor, family 52, subfamily B, member 4

13 Gene Product Result for
Synonyms: OR11-3
UniProtKB ID: Q8NGK2, A6NP68, Q6IFK6
Gene ID:
Human(143496) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(485223) cOR52B7 olfactory receptor family 52 subfamily B-like
cow(504857) olfactory receptor, family 52, subfamily B, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005161 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005161 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065150 predicted 626
2 SASI_Hs01_00065151 predicted 550
3 SASI_Hs01_00065152 predicted 490
4 SASI_Hs01_00065153 predicted 452
5 SASI_Hs01_00065154 predicted 564
6 SASI_Hs02_00304720 predicted 352
7 SASI_Hs01_00065155 predicted 438
8 SASI_Hs01_00065157 predicted 242
9 SASI_Hs01_00065158 predicted 280
10 SASI_Hs01_00065159 predicted 538
11 SASI_Hs01_00065156 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005161
OR52B4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily B, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-502s21c1
Sequence:CCGGTTGACTTTCTGCCAGAATAATCTCGAGATTATTCTGGCAGAAAGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-627s21c1
Sequence:CCGGGGTCTTAGATGTTGTACTAATCTCGAGATTAGTACAACATCTAAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-455s21c1
Sequence:CCGGTGAGAAGTTATGGTACAATTTCTCGAGAAATTGTACCATAACTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-400s21c1
Sequence:CCGGTACACCACCATTCTTACAAATCTCGAGATTTGTAAGAATGGTGGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-365s21c1
Sequence:CCGGTTGACCACTATATTGCCATATCTCGAGATATGGCAATATAGTGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-547s21c1
Sequence:CCGGCACATTGGCCTAGCCAAATATCTCGAGATATTTGGCTAGGCCAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-571s21c1
Sequence:CCGGTGTAATGACATTCGAATAAACCTCGAGGTTTATTCGAATGTCATTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005161
OR52B4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily B, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-502s21c1
Sequence:CCGGTTGACTTTCTGCCAGAATAATCTCGAGATTATTCTGGCAGAAAGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-627s21c1
Sequence:CCGGGGTCTTAGATGTTGTACTAATCTCGAGATTAGTACAACATCTAAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-455s21c1
Sequence:CCGGTGAGAAGTTATGGTACAATTTCTCGAGAAATTGTACCATAACTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-400s21c1
Sequence:CCGGTACACCACCATTCTTACAAATCTCGAGATTTGTAAGAATGGTGGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-365s21c1
Sequence:CCGGTTGACCACTATATTGCCATATCTCGAGATATGGCAATATAGTGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-547s21c1
Sequence:CCGGCACATTGGCCTAGCCAAATATCTCGAGATATTTGGCTAGGCCAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-571s21c1
Sequence:CCGGTGTAATGACATTCGAATAAACCTCGAGGTTTATTCGAATGTCATTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005161
OR52B4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily B, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-502s21c1
Sequence:CCGGTTGACTTTCTGCCAGAATAATCTCGAGATTATTCTGGCAGAAAGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-627s21c1
Sequence:CCGGGGTCTTAGATGTTGTACTAATCTCGAGATTAGTACAACATCTAAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-455s21c1
Sequence:CCGGTGAGAAGTTATGGTACAATTTCTCGAGAAATTGTACCATAACTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-400s21c1
Sequence:CCGGTACACCACCATTCTTACAAATCTCGAGATTTGTAAGAATGGTGGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-365s21c1
Sequence:CCGGTTGACCACTATATTGCCATATCTCGAGATATGGCAATATAGTGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-547s21c1
Sequence:CCGGCACATTGGCCTAGCCAAATATCTCGAGATATTTGGCTAGGCCAATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005161.2-571s21c1
Sequence:CCGGTGTAATGACATTCGAATAAACCTCGAGGTTTATTCGAATGTCATTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)