EMAIL THIS PAGE TO A FRIEND

OR52D1

olfactory receptor, family 52, subfamily D, member 1

18 Gene Product Result for
Synonyms: OR11-43
UniProtKB ID: Q9H346, B9EGY9, Q6IFI6
Gene ID:
Human(390066) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(788295) olfactory receptor, family 52, subfamily D, member 1
cow(100336857) olfactory receptor, family 52, subfamily D, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372359 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051161 MISSION® esiRNA esiRNA human OR52D1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005163 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217412 predicted 693
2 SASI_Hs01_00217414 predicted 399
3 SASI_Hs01_00217415 predicted 570
4 SASI_Hs01_00217416 predicted 435
5 SASI_Hs01_00217417 predicted 391
6 SASI_Hs01_00217418 predicted 448
7 SASI_Hs01_00217419 predicted 371
8 SASI_Hs01_00217420 predicted 624
9 SASI_Hs01_00217421 predicted 521
10 SASI_Hs02_00304723 predicted 521
11 SASI_Hs01_00217413 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372359
OR52D1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily D, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-454s1c1
Sequence:CCGGCTATTCCGTAGTGTGGCTATTCTCGAGAATAGCCACACTACGGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-394s1c2
Sequence:CCGGCCATTAAGGTACACAACCATTCTCGAGAATGGTTGTGTACCTTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-93s1c1
Sequence:CCGGCATCCCTTTCTGTGCCATGTACTCGAGTACATGGCACAGAAAGGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-637s1c1
Sequence:CCGGGATTCCATTCTCATTGCCATTCTCGAGAATGGCAATGAGAATGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-453s1c1
Sequence:CCGGGCTATTCCGTAGTGTGGCTATCTCGAGATAGCCACACTACGGAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372359
OR52D1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily D, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-454s1c1
Sequence:CCGGCTATTCCGTAGTGTGGCTATTCTCGAGAATAGCCACACTACGGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-394s1c2
Sequence:CCGGCCATTAAGGTACACAACCATTCTCGAGAATGGTTGTGTACCTTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-93s1c1
Sequence:CCGGCATCCCTTTCTGTGCCATGTACTCGAGTACATGGCACAGAAAGGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-637s1c1
Sequence:CCGGGATTCCATTCTCATTGCCATTCTCGAGAATGGCAATGAGAATGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-453s1c1
Sequence:CCGGGCTATTCCGTAGTGTGGCTATCTCGAGATAGCCACACTACGGAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372359
OR52D1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily D, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-454s1c1
Sequence:CCGGCTATTCCGTAGTGTGGCTATTCTCGAGAATAGCCACACTACGGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-394s1c2
Sequence:CCGGCCATTAAGGTACACAACCATTCTCGAGAATGGTTGTGTACCTTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-93s1c1
Sequence:CCGGCATCCCTTTCTGTGCCATGTACTCGAGTACATGGCACAGAAAGGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-637s1c1
Sequence:CCGGGATTCCATTCTCATTGCCATTCTCGAGAATGGCAATGAGAATGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372359.1-453s1c1
Sequence:CCGGGCTATTCCGTAGTGTGGCTATCTCGAGATAGCCACACTACGGAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)