EMAIL THIS PAGE TO A FRIEND

OR52E4

olfactory receptor, family 52, subfamily E, member 4

14 Gene Product Result for
Synonyms: OR11-55
UniProtKB ID: Q8NGH9, Q6IFG0
Gene ID:
Human(390081) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(507029) olfactory receptor, family 52, subfamily E, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501686 Anti-OR52E4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372368 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005165 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043590 predicted 430
2 SASI_Hs01_00043591 predicted 244
3 SASI_Hs01_00043592 predicted 434
4 SASI_Hs01_00043593 predicted 690
5 SASI_Hs02_00304727 predicted 304
6 SASI_Hs01_00043594 predicted 709
7 SASI_Hs01_00043595 predicted 630
8 SASI_Hs01_00043596 predicted 601
9 SASI_Hs01_00043597 predicted 698
10 SASI_Hs01_00043598 predicted 654
11 SASI_Hs01_00043599 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372368
OR52E4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily E, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-249s1c1
Sequence:CCGGGCTAGGAATCTTCTGGTTCAACTCGAGTTGAACCAGAAGATTCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-67s1c1
Sequence:CCGGGACACTTTACATATCTGGATTCTCGAGAATCCAGATATGTAAAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-689s1c1
Sequence:CCGGCCTCTCAAGATGTCCGACTAACTCGAGTTAGTCGGACATCTTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-574s1c1
Sequence:CCGGGCACCCATTAAGATCAACATACTCGAGTATGTTGATCTTAATGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-297s1c1
Sequence:CCGGCCTTCTTCAGATGTTCTTTATCTCGAGATAAAGAACATCTGAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-196s1c1
Sequence:CCGGGCCATGTTGTCTATGATTGATCTCGAGATCAATCATAGACAACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-690s1c2
Sequence:CCGGCTCTCAAGATGTCCGACTAAACTCGAGTTTAGTCGGACATCTTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372368
OR52E4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily E, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-249s1c1
Sequence:CCGGGCTAGGAATCTTCTGGTTCAACTCGAGTTGAACCAGAAGATTCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-67s1c1
Sequence:CCGGGACACTTTACATATCTGGATTCTCGAGAATCCAGATATGTAAAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-689s1c1
Sequence:CCGGCCTCTCAAGATGTCCGACTAACTCGAGTTAGTCGGACATCTTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-574s1c1
Sequence:CCGGGCACCCATTAAGATCAACATACTCGAGTATGTTGATCTTAATGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-297s1c1
Sequence:CCGGCCTTCTTCAGATGTTCTTTATCTCGAGATAAAGAACATCTGAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-196s1c1
Sequence:CCGGGCCATGTTGTCTATGATTGATCTCGAGATCAATCATAGACAACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-690s1c2
Sequence:CCGGCTCTCAAGATGTCCGACTAAACTCGAGTTTAGTCGGACATCTTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372368
OR52E4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily E, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-249s1c1
Sequence:CCGGGCTAGGAATCTTCTGGTTCAACTCGAGTTGAACCAGAAGATTCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-67s1c1
Sequence:CCGGGACACTTTACATATCTGGATTCTCGAGAATCCAGATATGTAAAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-689s1c1
Sequence:CCGGCCTCTCAAGATGTCCGACTAACTCGAGTTAGTCGGACATCTTGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-574s1c1
Sequence:CCGGGCACCCATTAAGATCAACATACTCGAGTATGTTGATCTTAATGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-297s1c1
Sequence:CCGGCCTTCTTCAGATGTTCTTTATCTCGAGATAAAGAACATCTGAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-196s1c1
Sequence:CCGGGCCATGTTGTCTATGATTGATCTCGAGATCAATCATAGACAACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372368.1-690s1c2
Sequence:CCGGCTCTCAAGATGTCCGACTAAACTCGAGTTTAGTCGGACATCTTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)