EMAIL THIS PAGE TO A FRIEND

OR52E5

olfactory receptor, family 52, subfamily E, member 5

11 Gene Product Result for
Synonyms: OR11-56
Species: Human OR52E5(390082)
UniProtKB ID: Q8NH55
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501687 Anti-OR52E5 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372369 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005166 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181361 predicted 526
2 SASI_Hs01_00181362 predicted 307
3 SASI_Hs01_00181363 predicted 719
4 SASI_Hs01_00181364 predicted 619
5 SASI_Hs01_00181365 predicted 435
6 SASI_Hs01_00181366 predicted 548
7 SASI_Hs01_00181367 predicted 301
8 SASI_Hs01_00181368 predicted 607
9 SASI_Hs01_00181369 predicted 573
10 SASI_Hs01_00181370 predicted 571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372369
OR52E5 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily E, member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-304s1c1
Sequence:CCGGGCCTGCATCACACAGATGTATCTCGAGATACATCTGTGTGATGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-616s1c1
Sequence:CCGGGCCTTCTCAGTGGGATACATTCTCGAGAATGTATCCCACTGAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-107s1c1
Sequence:CCGGCCTTCTTTGCAGTGTATCTAACTCGAGTTAGATACACTGCAAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-115s1c1
Sequence:CCGGGCAGTGTATCTAACAGCCCTTCTCGAGAAGGGCTGTTAGATACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-305s1c1
Sequence:CCGGCCTGCATCACACAGATGTATACTCGAGTATACATCTGTGTGATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-814s1c1
Sequence:CCGGCCTCATTACATCCACATTCTTCTCGAGAAGAATGTGGATGTAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-132s1c1
Sequence:CCGGCCTTCTAGGGAACATCATTATCTCGAGATAATGATGTTCCCTAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372369
OR52E5 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily E, member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-304s1c1
Sequence:CCGGGCCTGCATCACACAGATGTATCTCGAGATACATCTGTGTGATGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-616s1c1
Sequence:CCGGGCCTTCTCAGTGGGATACATTCTCGAGAATGTATCCCACTGAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-107s1c1
Sequence:CCGGCCTTCTTTGCAGTGTATCTAACTCGAGTTAGATACACTGCAAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-115s1c1
Sequence:CCGGGCAGTGTATCTAACAGCCCTTCTCGAGAAGGGCTGTTAGATACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-305s1c1
Sequence:CCGGCCTGCATCACACAGATGTATACTCGAGTATACATCTGTGTGATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-814s1c1
Sequence:CCGGCCTCATTACATCCACATTCTTCTCGAGAAGAATGTGGATGTAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-132s1c1
Sequence:CCGGCCTTCTAGGGAACATCATTATCTCGAGATAATGATGTTCCCTAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372369
OR52E5 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily E, member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-304s1c1
Sequence:CCGGGCCTGCATCACACAGATGTATCTCGAGATACATCTGTGTGATGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-616s1c1
Sequence:CCGGGCCTTCTCAGTGGGATACATTCTCGAGAATGTATCCCACTGAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-107s1c1
Sequence:CCGGCCTTCTTTGCAGTGTATCTAACTCGAGTTAGATACACTGCAAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-115s1c1
Sequence:CCGGGCAGTGTATCTAACAGCCCTTCTCGAGAAGGGCTGTTAGATACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-305s1c1
Sequence:CCGGCCTGCATCACACAGATGTATACTCGAGTATACATCTGTGTGATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-814s1c1
Sequence:CCGGCCTCATTACATCCACATTCTTCTCGAGAAGAATGTGGATGTAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372369.1-132s1c1
Sequence:CCGGCCTTCTAGGGAACATCATTATCTCGAGATAATGATGTTCCCTAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)