EMAIL THIS PAGE TO A FRIEND

OR52E8

olfactory receptor, family 52, subfamily E, member 8

14 Gene Product Result for
Synonyms: OR11-54
UniProtKB ID: Q6IFG1, B9EH38
Gene ID:
Human(390079) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(615216) olfactory receptor, family 52, subfamily E, member 8
dog(485306) olfactory receptor, family 52, subfamily E, member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005168 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127111 MISSION® esiRNA esiRNA human OR52E8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005168 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233926 predicted 732
2 SASI_Hs01_00233927 predicted 641
3 SASI_Hs01_00233928 predicted 298
4 SASI_Hs01_00233929 predicted 632
5 SASI_Hs01_00233930 predicted 615
6 SASI_Hs01_00233931 predicted 263
7 SASI_Hs01_00233932 predicted 625
8 SASI_Hs01_00233933 predicted 265
9 SASI_Hs01_00233934 predicted 600
10 SASI_Hs02_00304731 predicted 468
11 SASI_Hs01_00233935 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005168
OR52E8 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily E, member 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-615s1c1
Sequence:CCGGCCTTGGCAACATATCTCTCTTCTCGAGAAGAGAGATATGTTGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-135s1c1
Sequence:CCGGCCTGGGAAACACTGCTCTCTTCTCGAGAAGAGAGCAGTGTTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-32s1c1
Sequence:CCGGCCCAGTTCCATCCTTCTTCATCTCGAGATGAAGAAGGATGGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-586s1c1
Sequence:CCGGGCCAGCATCAAAGTCAACATTCTCGAGAATGTTGACTTTGATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-144s1c1
Sequence:CCGGCACTGCTCTCTTGTTTGTGATCTCGAGATCACAAACAAGAGAGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005168
OR52E8 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily E, member 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-615s1c1
Sequence:CCGGCCTTGGCAACATATCTCTCTTCTCGAGAAGAGAGATATGTTGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-135s1c1
Sequence:CCGGCCTGGGAAACACTGCTCTCTTCTCGAGAAGAGAGCAGTGTTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-32s1c1
Sequence:CCGGCCCAGTTCCATCCTTCTTCATCTCGAGATGAAGAAGGATGGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-586s1c1
Sequence:CCGGGCCAGCATCAAAGTCAACATTCTCGAGAATGTTGACTTTGATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-144s1c1
Sequence:CCGGCACTGCTCTCTTGTTTGTGATCTCGAGATCACAAACAAGAGAGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005168
OR52E8 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily E, member 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-615s1c1
Sequence:CCGGCCTTGGCAACATATCTCTCTTCTCGAGAAGAGAGATATGTTGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-135s1c1
Sequence:CCGGCCTGGGAAACACTGCTCTCTTCTCGAGAAGAGAGCAGTGTTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-32s1c1
Sequence:CCGGCCCAGTTCCATCCTTCTTCATCTCGAGATGAAGAAGGATGGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-586s1c1
Sequence:CCGGGCCAGCATCAAAGTCAACATTCTCGAGAATGTTGACTTTGATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005168.1-144s1c1
Sequence:CCGGCACTGCTCTCTTGTTTGTGATCTCGAGATCACAAACAAGAGAGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)