EMAIL THIS PAGE TO A FRIEND

OR52J3

olfactory receptor, family 52, subfamily J, member 3

16 Gene Product Result for
Synonyms: OR11-32
UniProtKB ID: Q8NH60, Q6IFE4
Gene ID:
Human(119679) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(491654) olfactory receptor, family 52, subfamily J, member 3
cow(785443) olfactory receptor, family 52, subfamily J, member 3
Domestic Rabbit(100328839) olfactory receptor, family 52, subfamily J, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305931 ANTI-OR52J3 (C-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_061611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_061611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_061611 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142361 MISSION® esiRNA esiRNA human OR52J3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001916 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303990 predicted 273
2 SASI_Hs01_00246921 predicted 426
3 SASI_Hs01_00246922 predicted 233
4 SASI_Hs01_00246923 predicted 687
5 SASI_Hs01_00246924 predicted 632
6 SASI_Hs02_00303991 predicted 397
7 SASI_Hs01_00246925 predicted 468
8 SASI_Hs01_00246926 predicted 298
9 SASI_Hs01_00246927 predicted 262
10 SASI_Hs01_00246928 predicted 511
11 SASI_Hs01_00246929 predicted 574
12 SASI_Hs01_00246930 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_061611
OR52J3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily J, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-271s1c1
Sequence:CCGGGCTCACGAGATTAACTATGGACTCGAGTCCATAGTTAATCTCGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-381s1c1
Sequence:CCGGCGTCTGTGCTCCACTACATTACTCGAGTAATGTAGTGGAGCACAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-514s1c1
Sequence:CCGGCAGGCTCACATAATAGCCCATCTCGAGATGGGCTATTATGTGAGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-301s1c1
Sequence:CCGGGCCCAGATGTTTCTGATCCATCTCGAGATGGATCAGAAACATCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-206s1c1
Sequence:CCGGCCACTATTGATTTGGCCCTTTCTCGAGAAAGGGCCAAATCAATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-640s1c1
Sequence:CCGGCTCATTGGCATCTCGTATGTTCTCGAGAACATACGAGATGCCAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-763s1c1
Sequence:CCGGCCTTCAGTCTTCTCTTTCCTTCTCGAGAAGGAAAGAGAAGACTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-531s1c1
Sequence:CCGGCCATTCCTACTGTGAGCACATCTCGAGATGTGCTCACAGTAGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_061611
OR52J3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily J, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-271s1c1
Sequence:CCGGGCTCACGAGATTAACTATGGACTCGAGTCCATAGTTAATCTCGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-381s1c1
Sequence:CCGGCGTCTGTGCTCCACTACATTACTCGAGTAATGTAGTGGAGCACAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-514s1c1
Sequence:CCGGCAGGCTCACATAATAGCCCATCTCGAGATGGGCTATTATGTGAGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-301s1c1
Sequence:CCGGGCCCAGATGTTTCTGATCCATCTCGAGATGGATCAGAAACATCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-206s1c1
Sequence:CCGGCCACTATTGATTTGGCCCTTTCTCGAGAAAGGGCCAAATCAATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-640s1c1
Sequence:CCGGCTCATTGGCATCTCGTATGTTCTCGAGAACATACGAGATGCCAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-763s1c1
Sequence:CCGGCCTTCAGTCTTCTCTTTCCTTCTCGAGAAGGAAAGAGAAGACTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-531s1c1
Sequence:CCGGCCATTCCTACTGTGAGCACATCTCGAGATGTGCTCACAGTAGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_061611
OR52J3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily J, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-271s1c1
Sequence:CCGGGCTCACGAGATTAACTATGGACTCGAGTCCATAGTTAATCTCGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-381s1c1
Sequence:CCGGCGTCTGTGCTCCACTACATTACTCGAGTAATGTAGTGGAGCACAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-514s1c1
Sequence:CCGGCAGGCTCACATAATAGCCCATCTCGAGATGGGCTATTATGTGAGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-301s1c1
Sequence:CCGGGCCCAGATGTTTCTGATCCATCTCGAGATGGATCAGAAACATCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-206s1c1
Sequence:CCGGCCACTATTGATTTGGCCCTTTCTCGAGAAAGGGCCAAATCAATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-640s1c1
Sequence:CCGGCTCATTGGCATCTCGTATGTTCTCGAGAACATACGAGATGCCAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-763s1c1
Sequence:CCGGCCTTCAGTCTTCTCTTTCCTTCTCGAGAAGGAAAGAGAAGACTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061611.2-531s1c1
Sequence:CCGGCCATTCCTACTGTGAGCACATCTCGAGATGTGCTCACAGTAGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)