EMAIL THIS PAGE TO A FRIEND

OR52M1

olfactory receptor, family 52, subfamily M, member 1

13 Gene Product Result for
Synonyms: OR11-11 OR52M1P OR52M3P
UniProtKB ID: Q8NGK5
Gene ID:
Human(119772) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(513681) olfactory receptor, family 52, subfamily M, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004137 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004137 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222556 predicted 635
2 SASI_Hs01_00222557 predicted 236
3 SASI_Hs01_00222558 predicted 689
4 SASI_Hs01_00222559 predicted 295
5 SASI_Hs01_00222560 predicted 393
6 SASI_Hs02_00304484 predicted 548
7 SASI_Hs01_00222561 predicted 254
8 SASI_Hs01_00222562 predicted 292
9 SASI_Hs01_00222563 predicted 320
10 SASI_Hs01_00222564 predicted 267
11 SASI_Hs01_00222565 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004137
OR52M1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily M, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-297s1c1
Sequence:CCGGCTTGGGCCAAATGTTCCTTATCTCGAGATAAGGAACATTTGGCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-771s1c1
Sequence:CCGGCATTGCTGTTTCTTCCCTGATCTCGAGATCAGGGAAGAAACAGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-229s1c1
Sequence:CCGGACTTCCACTATACCCAAACTTCTCGAGAAGTTTGGGTATAGTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-652s1c1
Sequence:CCGGGCTGCATCCTATGTGATGATTCTCGAGAATCATCACATAGGATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-522s1c1
Sequence:CCGGCCATGTTATCTCCCACTCCTACTCGAGTAGGAGTGGGAGATAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004137
OR52M1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily M, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-297s1c1
Sequence:CCGGCTTGGGCCAAATGTTCCTTATCTCGAGATAAGGAACATTTGGCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-771s1c1
Sequence:CCGGCATTGCTGTTTCTTCCCTGATCTCGAGATCAGGGAAGAAACAGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-229s1c1
Sequence:CCGGACTTCCACTATACCCAAACTTCTCGAGAAGTTTGGGTATAGTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-652s1c1
Sequence:CCGGGCTGCATCCTATGTGATGATTCTCGAGAATCATCACATAGGATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-522s1c1
Sequence:CCGGCCATGTTATCTCCCACTCCTACTCGAGTAGGAGTGGGAGATAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004137
OR52M1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily M, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-297s1c1
Sequence:CCGGCTTGGGCCAAATGTTCCTTATCTCGAGATAAGGAACATTTGGCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-771s1c1
Sequence:CCGGCATTGCTGTTTCTTCCCTGATCTCGAGATCAGGGAAGAAACAGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-229s1c1
Sequence:CCGGACTTCCACTATACCCAAACTTCTCGAGAAGTTTGGGTATAGTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-652s1c1
Sequence:CCGGGCTGCATCCTATGTGATGATTCTCGAGAATCATCACATAGGATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004137.1-522s1c1
Sequence:CCGGCCATGTTATCTCCCACTCCTACTCGAGTAGGAGTGGGAGATAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)