EMAIL THIS PAGE TO A FRIEND

OR52N1

olfactory receptor, family 52, subfamily N, member 1

16 Gene Product Result for
Synonyms: OR11-61
UniProtKB ID: Q8NH53, Q6IFF6
Gene ID:
Human(79473) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(504568) olfactory receptor, family 52, subfamily N, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001913 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001913 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177369 predicted 411
2 SASI_Hs01_00177370 predicted 570
3 SASI_Hs01_00177371 predicted 651
4 SASI_Hs01_00177372 predicted 651
5 SASI_Hs01_00177373 predicted 494
6 SASI_Hs01_00177374 predicted 649
7 SASI_Hs01_00177375 predicted 540
8 SASI_Hs01_00177376 predicted 626
9 SASI_Hs01_00177377 predicted 488
10 SASI_Hs01_00177378 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001913
OR52N1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily N, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001913.1-745s1c1
Sequence:CCGGGCCATAGTCCTCACCTATGTTCTCGAGAACATAGGTGAGGACTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001913.1-591s1c1
Sequence:CCGGCGCCATCTATGGTTTGATAGTCTCGAGACTATCAAACCATAGATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001913.1-114s1c1
Sequence:CCGGCATTGCTATTACAGGGAACTTCTCGAGAAGTTCCCTGTAATAGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001913
OR52N1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily N, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001913.1-745s1c1
Sequence:CCGGGCCATAGTCCTCACCTATGTTCTCGAGAACATAGGTGAGGACTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001913.1-591s1c1
Sequence:CCGGCGCCATCTATGGTTTGATAGTCTCGAGACTATCAAACCATAGATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001913.1-114s1c1
Sequence:CCGGCATTGCTATTACAGGGAACTTCTCGAGAAGTTCCCTGTAATAGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001913
OR52N1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily N, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001913.1-745s1c1
Sequence:CCGGGCCATAGTCCTCACCTATGTTCTCGAGAACATAGGTGAGGACTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001913.1-591s1c1
Sequence:CCGGCGCCATCTATGGTTTGATAGTCTCGAGACTATCAAACCATAGATGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001913.1-114s1c1
Sequence:CCGGCATTGCTATTACAGGGAACTTCTCGAGAAGTTCCCTGTAATAGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)