EMAIL THIS PAGE TO A FRIEND

OR52N4

olfactory receptor, family 52, subfamily N, member 4

16 Gene Product Result for
Synonyms: OR11-64
UniProtKB ID: Q8NGI2, B2RNP8, Q6IF77
Gene ID:
Human(390072) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(505362) Olfactory receptor 52N4-like
Domestic Rabbit(100328885) olfactory receptor, family 52, subfamily N, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501684 Anti-OR52N4 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372361 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132091 MISSION® esiRNA esiRNA human OR52N4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005175 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187257 predicted 260
2 SASI_Hs01_00187258 predicted 272
3 SASI_Hs01_00187260 predicted 497
4 SASI_Hs01_00187261 predicted 456
5 SASI_Hs01_00187262 predicted 503
6 SASI_Hs01_00187263 predicted 537
7 SASI_Hs01_00187264 predicted 630
8 SASI_Hs01_00187265 predicted 219
9 SASI_Hs02_00304735 predicted 646
10 SASI_Hs02_00304736 predicted 402
11 SASI_Hs01_00187256 predicted 418
12 SASI_Hs01_00187259 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372361
OR52N4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily N, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-559s1c1
Sequence:CCGGGCCAAATTGTCCTGTGGTAATCTCGAGATTACCACAGGACAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-112s1c1
Sequence:CCGGGTTGTGGCTATGGTAGGGAATCTCGAGATTCCCTACCATAGCCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-101s1c1
Sequence:CCGGGCTCTATGTATGTTGTGGCTACTCGAGTAGCCACAACATACATAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-225s1c1
Sequence:CCGGGTGCTCTAGTACAATCCCTAACTCGAGTTAGGGATTGTACTAGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-168s1c1
Sequence:CCGGCCTGCACAAACCCATGTACTACTCGAGTAGTACATGGGTTTGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372361
OR52N4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily N, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-559s1c1
Sequence:CCGGGCCAAATTGTCCTGTGGTAATCTCGAGATTACCACAGGACAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-112s1c1
Sequence:CCGGGTTGTGGCTATGGTAGGGAATCTCGAGATTCCCTACCATAGCCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-101s1c1
Sequence:CCGGGCTCTATGTATGTTGTGGCTACTCGAGTAGCCACAACATACATAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-225s1c1
Sequence:CCGGGTGCTCTAGTACAATCCCTAACTCGAGTTAGGGATTGTACTAGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-168s1c1
Sequence:CCGGCCTGCACAAACCCATGTACTACTCGAGTAGTACATGGGTTTGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372361
OR52N4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily N, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-559s1c1
Sequence:CCGGGCCAAATTGTCCTGTGGTAATCTCGAGATTACCACAGGACAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-112s1c1
Sequence:CCGGGTTGTGGCTATGGTAGGGAATCTCGAGATTCCCTACCATAGCCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-101s1c1
Sequence:CCGGGCTCTATGTATGTTGTGGCTACTCGAGTAGCCACAACATACATAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-225s1c1
Sequence:CCGGGTGCTCTAGTACAATCCCTAACTCGAGTTAGGGATTGTACTAGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372361.1-168s1c1
Sequence:CCGGCCTGCACAAACCCATGTACTACTCGAGTAGTACATGGGTTTGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)