EMAIL THIS PAGE TO A FRIEND

OR56A3

olfactory receptor, family 56, subfamily A, member 3

20 Gene Product Result for
Synonyms: OR56A2P OR56A3P OR56A6
UniProtKB ID: Q8NH54, A6NN77, Q6IFF7
Gene ID:
Human(390083) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(509567) olfactory receptor, family 56, subfamily A, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501688 Anti-OR56A3 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372370 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003443 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304288 predicted 434
2 SASI_Hs01_00237187 predicted 711
3 SASI_Hs02_00304289 predicted 509
4 SASI_Hs02_00304290 predicted 458
5 SASI_Hs01_00237189 predicted 674
6 SASI_Hs02_00304291 predicted 390
7 SASI_Hs02_00304292 predicted 506
8 SASI_Hs01_00237190 predicted 586
9 SASI_Hs02_00304293 predicted 395
10 SASI_Hs02_00304294 predicted 627
11 SASI_Hs01_00237186 predicted 359
12 SASI_Hs01_00237188 predicted 410
13 SASI_Hs01_00237191 predicted 322
14 SASI_Hs01_00237192 predicted 345
15 SASI_Hs01_00237193 predicted 361
16 SASI_Hs01_00237194 predicted 345
17 SASI_Hs01_00237195 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372370
OR56A3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 56, subfamily A, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-741s1c1
Sequence:CCGGCCACTTCATGCTCATCCTCTTCTCGAGAAGAGGATGAGCATGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-496s1c1
Sequence:CCGGCTTTCAGCACAACTCCGTTATCTCGAGATAACGGAGTTGTGCTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-537s1c1
Sequence:CCGGGAACTGCATCTGTGCCAATATCTCGAGATATTGGCACAGATGCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-37s1c1
Sequence:CCGGGCTTCAGACTTCCTCTTGAATCTCGAGATTCAAGAGGAAGTCTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-645s1c1
Sequence:CCGGCATCCTTATCTTCCTCTCCTACTCGAGTAGGAGAGGAAGATAAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-253s1c1
Sequence:CCGGGTCCTGACCATCTTCTGGTTTCTCGAGAAACCAGAAGATGGTCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372370
OR56A3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 56, subfamily A, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-741s1c1
Sequence:CCGGCCACTTCATGCTCATCCTCTTCTCGAGAAGAGGATGAGCATGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-496s1c1
Sequence:CCGGCTTTCAGCACAACTCCGTTATCTCGAGATAACGGAGTTGTGCTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-537s1c1
Sequence:CCGGGAACTGCATCTGTGCCAATATCTCGAGATATTGGCACAGATGCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-37s1c1
Sequence:CCGGGCTTCAGACTTCCTCTTGAATCTCGAGATTCAAGAGGAAGTCTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-645s1c1
Sequence:CCGGCATCCTTATCTTCCTCTCCTACTCGAGTAGGAGAGGAAGATAAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-253s1c1
Sequence:CCGGGTCCTGACCATCTTCTGGTTTCTCGAGAAACCAGAAGATGGTCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372370
OR56A3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 56, subfamily A, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-741s1c1
Sequence:CCGGCCACTTCATGCTCATCCTCTTCTCGAGAAGAGGATGAGCATGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-496s1c1
Sequence:CCGGCTTTCAGCACAACTCCGTTATCTCGAGATAACGGAGTTGTGCTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-537s1c1
Sequence:CCGGGAACTGCATCTGTGCCAATATCTCGAGATATTGGCACAGATGCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-37s1c1
Sequence:CCGGGCTTCAGACTTCCTCTTGAATCTCGAGATTCAAGAGGAAGTCTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-645s1c1
Sequence:CCGGCATCCTTATCTTCCTCTCCTACTCGAGTAGGAGAGGAAGATAAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372370.1-253s1c1
Sequence:CCGGGTCCTGACCATCTTCTGGTTTCTCGAGAAACCAGAAGATGGTCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)