EMAIL THIS PAGE TO A FRIEND

OR56B1

olfactory receptor, family 56, subfamily B, member 1

19 Gene Product Result for
Synonyms: OR11-65 OR56B1P
Species: Human OR56B1(387748)
UniProtKB ID: Q8NGI3, B2RNY6, B3KV42, Q6IF76
Gene ID:
Human(387748) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005180 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131911 MISSION® esiRNA esiRNA human OR56B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005180 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226909 predicted 602
2 SASI_Hs01_00226911 predicted 649
3 SASI_Hs01_00226912 predicted 414
4 SASI_Hs01_00226913 predicted 243
5 SASI_Hs02_00304741 predicted 428
6 SASI_Hs01_00226914 predicted 275
7 SASI_Hs01_00226915 predicted 595
8 SASI_Hs01_00226917 predicted 652
9 SASI_Hs01_00226918 predicted 229
10 SASI_Hs02_00304742 predicted 359
11 SASI_Hs01_00226910 predicted 603
12 SASI_Hs01_00226916 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005180
OR56B1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 56, subfamily B, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-606s1c1
Sequence:CCGGGCCAAACAGCATTTGCCAGTTCTCGAGAACTGGCAAATGCTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-522s1c1
Sequence:CCGGGCGTGATTATTGCTCCAAGAACTCGAGTTCTTGGAGCAATAATCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-412s1c1
Sequence:CCGGCCTCTTCGCTATCCATCAATTCTCGAGAATTGATGGATAGCGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-249s1c1
Sequence:CCGGCACTACTATCATCCCTAAGATCTCGAGATCTTAGGGATGATAGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-816s1c1
Sequence:CCGGGACAGAGATGAAGGCTACTTTCTCGAGAAAGTAGCCTTCATCTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005180.1-512s21c1
Sequence:CCGGTTGCAGCACAGCGTGATTATTCTCGAGAATAATCACGCTGTGCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005180.1-238s21c1
Sequence:CCGGATGGGTCTGGCCACTACTATCCTCGAGGATAGTAGTGGCCAGACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005180.1-472s21c1
Sequence:CCGGGTGCTGAGAAATGGCTTATTTCTCGAGAAATAAGCCATTTCTCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005180
OR56B1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 56, subfamily B, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-606s1c1
Sequence:CCGGGCCAAACAGCATTTGCCAGTTCTCGAGAACTGGCAAATGCTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-522s1c1
Sequence:CCGGGCGTGATTATTGCTCCAAGAACTCGAGTTCTTGGAGCAATAATCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-412s1c1
Sequence:CCGGCCTCTTCGCTATCCATCAATTCTCGAGAATTGATGGATAGCGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-249s1c1
Sequence:CCGGCACTACTATCATCCCTAAGATCTCGAGATCTTAGGGATGATAGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-816s1c1
Sequence:CCGGGACAGAGATGAAGGCTACTTTCTCGAGAAAGTAGCCTTCATCTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005180.1-512s21c1
Sequence:CCGGTTGCAGCACAGCGTGATTATTCTCGAGAATAATCACGCTGTGCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005180.1-238s21c1
Sequence:CCGGATGGGTCTGGCCACTACTATCCTCGAGGATAGTAGTGGCCAGACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005180.1-472s21c1
Sequence:CCGGGTGCTGAGAAATGGCTTATTTCTCGAGAAATAAGCCATTTCTCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005180
OR56B1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 56, subfamily B, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-606s1c1
Sequence:CCGGGCCAAACAGCATTTGCCAGTTCTCGAGAACTGGCAAATGCTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-522s1c1
Sequence:CCGGGCGTGATTATTGCTCCAAGAACTCGAGTTCTTGGAGCAATAATCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-412s1c1
Sequence:CCGGCCTCTTCGCTATCCATCAATTCTCGAGAATTGATGGATAGCGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-249s1c1
Sequence:CCGGCACTACTATCATCCCTAAGATCTCGAGATCTTAGGGATGATAGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005180.1-816s1c1
Sequence:CCGGGACAGAGATGAAGGCTACTTTCTCGAGAAAGTAGCCTTCATCTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005180.1-512s21c1
Sequence:CCGGTTGCAGCACAGCGTGATTATTCTCGAGAATAATCACGCTGTGCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005180.1-238s21c1
Sequence:CCGGATGGGTCTGGCCACTACTATCCTCGAGGATAGTAGTGGCCAGACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005180.1-472s21c1
Sequence:CCGGGTGCTGAGAAATGGCTTATTTCTCGAGAAATAAGCCATTTCTCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)