EMAIL THIS PAGE TO A FRIEND

OR56B4

olfactory receptor, family 56, subfamily B, member 4

18 Gene Product Result for
Synonyms: OR11-67
Species: Human OR56B4(196335)
UniProtKB ID: Q8NH76, Q6IFD7
Gene ID:
Human(196335) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500728 Anti-OR56B4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_115092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_115092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_115092 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005181 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170573 predicted 628
2 SASI_Hs01_00170574 predicted 515
3 SASI_Hs02_00304743 predicted 622
4 SASI_Hs01_00170575 predicted 638
5 SASI_Hs02_00304744 predicted 585
6 SASI_Hs01_00170576 predicted 463
7 SASI_Hs02_00304745 predicted 635
8 SASI_Hs01_00170578 predicted 634
9 SASI_Hs01_00170579 predicted 339
10 SASI_Hs01_00170581 predicted 463
11 SASI_Hs01_00170577 predicted 538
12 SASI_Hs01_00170580 predicted 375
13 SASI_Hs01_00170582 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005181
OR56B4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 56, subfamily B, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-27s21c1
Sequence:CCGGTGACTCCAGCCTCCAGATTTCCTCGAGGAAATCTGGAGGCTGGAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-589s21c1
Sequence:CCGGGACATCACTGTGAACAAATTTCTCGAGAAATTTGTTCACAGTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-196s21c1
Sequence:CCGGTACCATTTGCTGGGCATATTACTCGAGTAATATGCCCAGCAAATGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-138s21c1
Sequence:CCGGTGCCAACCTCCTCATCATAATCTCGAGATTATGATGAGGAGGTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-371s21c1
Sequence:CCGGTGGCAGTAGACAGATACATAGCTCGAGCTATGTATCTGTCTACTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-61s21c1
Sequence:CCGGATGGGATTACCAGGCATTCATCTCGAGATGAATGCCTGGTAATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-631s21c1
Sequence:CCGGGTCTTGGTTGGGAGTGATATGCTCGAGCATATCACTCCCAACCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-481s21c1
Sequence:CCGGTTGACCATCCCAGTGCCTATACTCGAGTATAGGCACTGGGATGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005181
OR56B4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 56, subfamily B, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-27s21c1
Sequence:CCGGTGACTCCAGCCTCCAGATTTCCTCGAGGAAATCTGGAGGCTGGAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-589s21c1
Sequence:CCGGGACATCACTGTGAACAAATTTCTCGAGAAATTTGTTCACAGTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-196s21c1
Sequence:CCGGTACCATTTGCTGGGCATATTACTCGAGTAATATGCCCAGCAAATGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-138s21c1
Sequence:CCGGTGCCAACCTCCTCATCATAATCTCGAGATTATGATGAGGAGGTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-371s21c1
Sequence:CCGGTGGCAGTAGACAGATACATAGCTCGAGCTATGTATCTGTCTACTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-61s21c1
Sequence:CCGGATGGGATTACCAGGCATTCATCTCGAGATGAATGCCTGGTAATCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-631s21c1
Sequence:CCGGGTCTTGGTTGGGAGTGATATGCTCGAGCATATCACTCCCAACCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-481s21c1
Sequence:CCGGTTGACCATCCCAGTGCCTATACTCGAGTATAGGCACTGGGATGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005181
OR56B4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 56, subfamily B, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-27s21c1
Sequence:CCGGTGACTCCAGCCTCCAGATTTCCTCGAGGAAATCTGGAGGCTGGAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-589s21c1
Sequence:CCGGGACATCACTGTGAACAAATTTCTCGAGAAATTTGTTCACAGTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-196s21c1
Sequence:CCGGTACCATTTGCTGGGCATATTACTCGAGTAATATGCCCAGCAAATGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-138s21c1
Sequence:CCGGTGCCAACCTCCTCATCATAATCTCGAGATTATGATGAGGAGGTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-371s21c1
Sequence:CCGGTGGCAGTAGACAGATACATAGCTCGAGCTATGTATCTGTCTACTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-61s21c1
Sequence:CCGGATGGGATTACCAGGCATTCATCTCGAGATGAATGCCTGGTAATCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-631s21c1
Sequence:CCGGGTCTTGGTTGGGAGTGATATGCTCGAGCATATCACTCCCAACCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005181.1-481s21c1
Sequence:CCGGTTGACCATCCCAGTGCCTATACTCGAGTATAGGCACTGGGATGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_115092
OR56B4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 56, subfamily B, member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-699s1c1
Sequence:CCGGGCTGAACTCAGCAGAAGCAATCTCGAGATTGCTTCTGCTGAGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-368s1c1
Sequence:CCGGGCATGGCAGTAGACAGATACACTCGAGTGTATCTGTCTACTGCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-36s1c1
Sequence:CCGGCCTCCAGATTTCCCAGTTCATCTCGAGATGAACTGGGAAATCTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-519s1c1
Sequence:CCGGCTACTGTTCCAGGAATGAAATCTCGAGATTTCATTCCTGGAACAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_115092
OR56B4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 56, subfamily B, member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-699s1c1
Sequence:CCGGGCTGAACTCAGCAGAAGCAATCTCGAGATTGCTTCTGCTGAGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-368s1c1
Sequence:CCGGGCATGGCAGTAGACAGATACACTCGAGTGTATCTGTCTACTGCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-36s1c1
Sequence:CCGGCCTCCAGATTTCCCAGTTCATCTCGAGATGAACTGGGAAATCTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-519s1c1
Sequence:CCGGCTACTGTTCCAGGAATGAAATCTCGAGATTTCATTCCTGGAACAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_115092
OR56B4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 56, subfamily B, member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-699s1c1
Sequence:CCGGGCTGAACTCAGCAGAAGCAATCTCGAGATTGCTTCTGCTGAGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-368s1c1
Sequence:CCGGGCATGGCAGTAGACAGATACACTCGAGTGTATCTGTCTACTGCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-36s1c1
Sequence:CCGGCCTCCAGATTTCCCAGTTCATCTCGAGATGAACTGGGAAATCTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_115092.2-519s1c1
Sequence:CCGGCTACTGTTCCAGGAATGAAATCTCGAGATTTCATTCCTGGAACAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)