EMAIL THIS PAGE TO A FRIEND

OR5AK2

olfactory receptor, family 5, subfamily AK, member 2

14 Gene Product Result for
UniProtKB ID: Q8NH90, B2RNZ9
Gene ID:
Human(390181) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483502) cOR5AK7 olfactory receptor family 5 subfamily AK-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305871 ANTI-OR5AK2(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372405 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011601 MISSION® esiRNA esiRNA targeting human OR5AK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005323 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157601 predicted 442
2 SASI_Hs01_00157602 predicted 406
3 SASI_Hs01_00157603 predicted 558
4 SASI_Hs01_00157604 predicted 420
5 SASI_Hs01_00157605 predicted 283
6 SASI_Hs01_00157606 predicted 283
7 SASI_Hs01_00157607 predicted 291
8 SASI_Hs01_00157608 predicted 347
9 SASI_Hs01_00157609 predicted 592
10 SASI_Hs01_00157610 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372405
OR5AK2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily AK, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000187918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-556s1c1
Sequence:CCGGGCTCTTTCATGCTCCAATGTTCTCGAGAACATTGGAGCATGAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-97s1c1
Sequence:CCGGCTCATCTATGTGACCTCCATACTCGAGTATGGAGGTCACATAGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-574s1c1
Sequence:CCGGGTTGACATCAACATCATGCTACTCGAGTAGCATGATGTTGATGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-99s1c1
Sequence:CCGGCATCTATGTGACCTCCATAATCTCGAGATTATGGAGGTCACATAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372405
OR5AK2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily AK, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000187918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-556s1c1
Sequence:CCGGGCTCTTTCATGCTCCAATGTTCTCGAGAACATTGGAGCATGAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-97s1c1
Sequence:CCGGCTCATCTATGTGACCTCCATACTCGAGTATGGAGGTCACATAGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-574s1c1
Sequence:CCGGGTTGACATCAACATCATGCTACTCGAGTAGCATGATGTTGATGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-99s1c1
Sequence:CCGGCATCTATGTGACCTCCATAATCTCGAGATTATGGAGGTCACATAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372405
OR5AK2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily AK, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000187918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-556s1c1
Sequence:CCGGGCTCTTTCATGCTCCAATGTTCTCGAGAACATTGGAGCATGAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-97s1c1
Sequence:CCGGCTCATCTATGTGACCTCCATACTCGAGTATGGAGGTCACATAGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-574s1c1
Sequence:CCGGGTTGACATCAACATCATGCTACTCGAGTAGCATGATGTTGATGTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372405.1-99s1c1
Sequence:CCGGCATCTATGTGACCTCCATAATCTCGAGATTATGGAGGTCACATAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)